Incidental Mutation 'R4753:Gcn1l1'
ID357726
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
MMRRC Submission 041971-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R4753 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115616478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2379 (V2379A)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably benign
Transcript: ENSMUST00000064454
AA Change: V2379A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: V2379A

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094427
SMART Domains Protein: ENSMUSP00000091994
Gene: ENSMUSG00000041638

DomainStartEndE-ValueType
Pfam:HEAT 42 72 5.8e-5 PFAM
low complexity region 310 318 N/A INTRINSIC
Pfam:HEAT_EZ 326 374 2.2e-5 PFAM
Blast:EZ_HEAT 403 439 1e-15 BLAST
Pfam:HEAT_EZ 703 757 1.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139933
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T A 13: 112,363,475 D257E probably benign Het
Arhgef18 T C 8: 3,444,938 V399A probably damaging Het
Atp8b5 C T 4: 43,372,710 P1117S probably damaging Het
Cd48 A G 1: 171,699,588 Q194R probably damaging Het
Cdk13 G A 13: 17,763,248 R737C probably damaging Het
Clasrp A T 7: 19,594,940 I89N probably damaging Het
Clrn1 G T 3: 58,884,897 N48K probably damaging Het
Cntrl T A 2: 35,153,439 V1313E possibly damaging Het
Cyld T A 8: 88,744,816 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dtl T C 1: 191,569,703 T81A probably damaging Het
Dus1l C T 11: 120,792,075 E299K probably benign Het
E130114P18Rik A T 4: 97,574,892 D14E possibly damaging Het
Fam83g C A 11: 61,695,269 H228N probably damaging Het
Fhod3 A T 18: 25,090,325 K909N possibly damaging Het
Fign T A 2: 63,979,019 I636L probably benign Het
Foxm1 A G 6: 128,372,556 E346G probably null Het
Gcc2 T C 10: 58,290,382 Y1271H probably benign Het
Grin2d G T 7: 45,833,906 P949Q probably damaging Het
Ighv1-43 C A 12: 114,946,142 M53I probably benign Het
Itgad A G 7: 128,223,703 *97W probably null Het
Jade1 C T 3: 41,596,671 R2* probably null Het
Lama3 G T 18: 12,482,084 C1355F probably damaging Het
Map3k13 T C 16: 21,892,002 S12P probably benign Het
Masp2 A G 4: 148,612,151 T402A probably benign Het
Mill1 A C 7: 18,262,547 K96T probably benign Het
Muc19 T G 15: 91,877,761 noncoding transcript Het
Muc5b C A 7: 141,856,853 T1321N unknown Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1377 T C 11: 50,985,151 V150A probably benign Het
Olfr395 T A 11: 73,906,851 I214F probably damaging Het
Pdgfra C T 5: 75,181,524 P669S probably damaging Het
Procr A G 2: 155,753,464 N63D probably damaging Het
Prrc2c A G 1: 162,691,230 S2136P probably damaging Het
Rab11fip1 T C 8: 27,152,741 M677V probably benign Het
Rad52 T A 6: 119,912,985 probably benign Het
Rasa1 A G 13: 85,288,390 probably null Het
Rogdi T C 16: 5,010,499 T189A probably damaging Het
Rph3al G A 11: 75,909,019 T38M probably damaging Het
Rps6ka2 T A 17: 7,299,308 V655E possibly damaging Het
Sik3 T C 9: 46,198,214 F499L probably damaging Het
Skint4 A G 4: 112,146,531 N387S probably benign Het
Slc6a12 C T 6: 121,356,903 probably benign Het
Stk36 A G 1: 74,626,096 T667A probably benign Het
Svep1 T C 4: 58,053,212 I3378V probably benign Het
Thnsl1 C T 2: 21,213,364 T122I probably damaging Het
Timeless G A 10: 128,240,020 probably benign Het
Tnxb G A 17: 34,695,935 V1966I possibly damaging Het
Tril A G 6: 53,819,713 F175L probably damaging Het
Vav1 A G 17: 57,306,140 Y604C probably damaging Het
Zfp423 T A 8: 87,781,446 M736L probably benign Het
Zscan10 A C 17: 23,607,234 E123D probably damaging Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 intron probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCTACCTACCGCAGTCTTG -3'
(R):5'- CGAATGGCAGCATCCACTTTG -3'

Sequencing Primer
(F):5'- ACCGCAGTCTTGACTTGTG -3'
(R):5'- TTGGAGCCTGCACCCTGAATC -3'
Posted On2015-11-11