Incidental Mutation 'R4754:Nlrp4g'
ID357826
Institutional Source Beutler Lab
Gene Symbol Nlrp4g
Ensembl Gene ENSMUSG00000079741
Gene NameNLR family, pyrin domain containing 4G
Synonymsnalp4g
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4754 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location124348831-124354028 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 124349788 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067621
SMART Domains Protein: ENSMUSP00000065508
Gene: ENSMUSG00000079741

DomainStartEndE-ValueType
Pfam:NACHT 69 238 1.5e-39 PFAM
Blast:LRR 555 582 9e-10 BLAST
Blast:LRR 610 637 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217183
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (107/109)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,393 F151L probably benign Het
4932438A13Rik C T 3: 37,022,466 Q3663* probably null Het
A130010J15Rik A G 1: 193,174,529 Y63C probably damaging Het
Abcb4 C A 5: 8,910,717 F266L probably damaging Het
Adam8 A T 7: 139,984,780 I681N possibly damaging Het
Adgrf3 T A 5: 30,197,617 probably null Het
Ang2 A G 14: 51,195,517 V136A probably damaging Het
Ankar C T 1: 72,698,694 G110R probably damaging Het
Ap3b1 T C 13: 94,403,960 L130P probably damaging Het
Apc2 T G 10: 80,314,358 W1749G probably benign Het
Asb2 T C 12: 103,323,837 N565S possibly damaging Het
B3gnt7 C A 1: 86,305,557 T58K probably benign Het
Brpf1 T A 6: 113,320,447 N876K possibly damaging Het
Ccdc157 T C 11: 4,148,994 I69V possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh20 A T 1: 104,984,685 I555F probably damaging Het
Cfap73 T C 5: 120,629,664 D274G probably damaging Het
Chd5 T A 4: 152,377,746 I1310N probably damaging Het
Ckap2 T A 8: 22,168,895 I611F possibly damaging Het
Cpeb2 A G 5: 43,285,857 I964V possibly damaging Het
Ctbp2 C A 7: 133,023,558 probably null Het
Dhrs2 A T 14: 55,238,748 I142F probably damaging Het
Dnah5 T A 15: 28,420,955 probably null Het
Dst T C 1: 34,212,309 S1822P probably damaging Het
Ect2 T C 3: 27,126,963 K581E probably damaging Het
Edem1 C T 6: 108,841,697 T222M probably damaging Het
Eif2ak1 A G 5: 143,901,803 M592V probably damaging Het
Endou T G 15: 97,726,539 D49A probably damaging Het
Ensa A G 3: 95,622,554 probably benign Het
Evc2 G T 5: 37,387,031 R708L probably damaging Het
Fam120b T A 17: 15,422,962 C668S probably damaging Het
Fam135a A T 1: 24,028,754 C798* probably null Het
Fam135b T C 15: 71,462,951 D798G probably benign Het
Fam208a A T 14: 27,461,095 I504L probably benign Het
Fshb A C 2: 107,057,282 *131E probably null Het
G3bp2 C T 5: 92,054,909 V441M possibly damaging Het
Galnt6 A T 15: 100,699,224 F354I probably damaging Het
Gm1123 C A 9: 99,023,240 probably null Het
Gm1123 A T 9: 99,023,241 probably null Het
Gm15130 T C 2: 111,142,862 N115S unknown Het
Gm7104 A G 12: 88,285,995 noncoding transcript Het
Gm9762 A T 3: 78,966,421 noncoding transcript Het
Grip2 A G 6: 91,779,182 V508A probably damaging Het
Grip2 T C 6: 91,779,192 T505A probably damaging Het
Haus4 A G 14: 54,549,892 probably null Het
Herc1 T A 9: 66,501,206 D4571E probably benign Het
Hnrnpk T A 13: 58,399,136 probably benign Het
Ica1l T C 1: 60,028,162 Y23C probably damaging Het
Kansl2-ps A G 7: 72,673,133 noncoding transcript Het
Kcnma1 T C 14: 23,363,836 D833G probably damaging Het
Kmt2e A T 5: 23,482,441 I430F possibly damaging Het
Lama2 C A 10: 27,118,531 R1794L possibly damaging Het
Mcpt1 T A 14: 56,018,680 F59I probably damaging Het
Mib2 G T 4: 155,655,365 T783K possibly damaging Het
Obscn T C 11: 59,036,043 I6352V possibly damaging Het
Olfr1245 A T 2: 89,575,047 H226Q probably benign Het
Olfr1456-ps1 T A 19: 13,078,861 noncoding transcript Het
Olfr531 C T 7: 140,400,159 A296T probably damaging Het
Olfr68 T C 7: 103,777,668 I226V probably benign Het
Olfr728 T A 14: 50,140,033 N202I possibly damaging Het
Olfr728 T G 14: 50,140,034 N202H probably benign Het
Pcdh10 G A 3: 45,380,637 R462H probably damaging Het
Pcdhga12 C A 18: 37,766,551 N145K probably damaging Het
Pik3r6 T A 11: 68,544,775 L613Q probably damaging Het
Pknox2 T C 9: 36,909,720 D282G probably damaging Het
Plod2 T G 9: 92,606,531 Y624* probably null Het
Prkd3 C A 17: 78,956,614 V684F probably damaging Het
Ptpn1 T A 2: 167,974,160 V198D probably damaging Het
Ptpn12 G T 5: 20,998,589 P397Q probably benign Het
Rad1 C A 15: 10,493,126 probably benign Het
Rasl11a A G 5: 146,847,015 D90G probably benign Het
Rnf181 A G 6: 72,360,560 probably benign Het
Ryr3 T C 2: 112,757,639 I2652M possibly damaging Het
Siglecg C T 7: 43,411,871 probably benign Het
Slc22a3 T C 17: 12,507,195 S44G probably benign Het
Slc38a1 A T 15: 96,576,782 F463I probably damaging Het
Smg1 A T 7: 118,156,731 probably benign Het
Syk T C 13: 52,612,259 probably benign Het
Tbc1d5 T C 17: 50,800,165 I454M probably benign Het
Tmed6 C A 8: 107,063,730 D146Y probably damaging Het
Tmem132e A T 11: 82,444,851 K828* probably null Het
Tmprss15 A T 16: 79,054,124 S294T probably damaging Het
Trp53bp1 A G 2: 121,207,879 S1493P probably damaging Het
Tshb A T 3: 102,778,175 I46N probably damaging Het
Tspan11 T C 6: 127,938,220 V99A probably benign Het
Ttn T C 2: 76,715,561 T24176A probably benign Het
Vmn1r8 T C 6: 57,035,967 M1T probably null Het
Vmn2r104 A T 17: 20,040,768 Y464* probably null Het
Vmn2r110 T C 17: 20,596,196 T22A probably benign Het
Vmn2r17 T A 5: 109,452,849 I671K probably damaging Het
Zbtb21 T C 16: 97,951,266 N606D probably damaging Het
Zfy2 A T Y: 2,121,477 S139T probably benign Het
Zkscan17 G A 11: 59,503,025 R156* probably null Het
Zp2 A G 7: 120,138,318 V248A probably benign Het
Other mutations in Nlrp4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Nlrp4g APN 9 124349526 unclassified noncoding transcript
IGL01087:Nlrp4g APN 9 124353858 critical splice acceptor site noncoding transcript
IGL01106:Nlrp4g APN 9 124350452 unclassified noncoding transcript
IGL01938:Nlrp4g APN 9 124349068 unclassified noncoding transcript
IGL02088:Nlrp4g APN 9 124350453 unclassified noncoding transcript
IGL02170:Nlrp4g APN 9 124348980 unclassified noncoding transcript
IGL02582:Nlrp4g APN 9 124349764 unclassified noncoding transcript
IGL02588:Nlrp4g APN 9 124348843 unclassified noncoding transcript
IGL02931:Nlrp4g APN 9 124348940 unclassified noncoding transcript
IGL03111:Nlrp4g APN 9 124353978 exon noncoding transcript
IGL03373:Nlrp4g APN 9 124349853 unclassified noncoding transcript
R0617:Nlrp4g UTSW 9 124349540 unclassified noncoding transcript
R1419:Nlrp4g UTSW 9 124349434 unclassified noncoding transcript
R2060:Nlrp4g UTSW 9 124349693 unclassified noncoding transcript
R2152:Nlrp4g UTSW 9 124353339 exon noncoding transcript
R2356:Nlrp4g UTSW 9 124349306 unclassified noncoding transcript
R2384:Nlrp4g UTSW 9 124349707 unclassified noncoding transcript
R2698:Nlrp4g UTSW 9 124349630 unclassified noncoding transcript
R3878:Nlrp4g UTSW 9 124349362 unclassified noncoding transcript
R4640:Nlrp4g UTSW 9 124349153 unclassified noncoding transcript
R4745:Nlrp4g UTSW 9 124349515 unclassified noncoding transcript
R4937:Nlrp4g UTSW 9 124354005 exon noncoding transcript
R5024:Nlrp4g UTSW 9 124350155 unclassified noncoding transcript
R5162:Nlrp4g UTSW 9 124350394 unclassified noncoding transcript
R5407:Nlrp4g UTSW 9 124349930 unclassified noncoding transcript
R5521:Nlrp4g UTSW 9 124350020 unclassified noncoding transcript
Z1088:Nlrp4g UTSW 9 124349201 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCCTTCAGTTTGGTGAGAGAAAAC -3'
(R):5'- ACCTCCTGAACAGATGGGTG -3'

Sequencing Primer
(F):5'- CGAGCAGCTGTTCACTATATGTCAG -3'
(R):5'- CTGAACAGATGGGTGGAGGAATATG -3'
Posted On2015-11-11