Incidental Mutation 'R4754:Lama2'
ID357828
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R4754 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27118531 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1794 (R1794L)
Ref Sequence ENSEMBL: ENSMUSP00000090304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639]
PDB Structure
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092639
AA Change: R1794L

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: R1794L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,393 F151L probably benign Het
4932438A13Rik C T 3: 37,022,466 Q3663* probably null Het
A130010J15Rik A G 1: 193,174,529 Y63C probably damaging Het
Abcb4 C A 5: 8,910,717 F266L probably damaging Het
Adam8 A T 7: 139,984,780 I681N possibly damaging Het
Adgrf3 T A 5: 30,197,617 probably null Het
Ang2 A G 14: 51,195,517 V136A probably damaging Het
Ankar C T 1: 72,698,694 G110R probably damaging Het
Ap3b1 T C 13: 94,403,960 L130P probably damaging Het
Apc2 T G 10: 80,314,358 W1749G probably benign Het
Asb2 T C 12: 103,323,837 N565S possibly damaging Het
B3gnt7 C A 1: 86,305,557 T58K probably benign Het
Brpf1 T A 6: 113,320,447 N876K possibly damaging Het
Ccdc157 T C 11: 4,148,994 I69V possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh20 A T 1: 104,984,685 I555F probably damaging Het
Cfap73 T C 5: 120,629,664 D274G probably damaging Het
Chd5 T A 4: 152,377,746 I1310N probably damaging Het
Ckap2 T A 8: 22,168,895 I611F possibly damaging Het
Cpeb2 A G 5: 43,285,857 I964V possibly damaging Het
Ctbp2 C A 7: 133,023,558 probably null Het
Dhrs2 A T 14: 55,238,748 I142F probably damaging Het
Dnah5 T A 15: 28,420,955 probably null Het
Dst T C 1: 34,212,309 S1822P probably damaging Het
Ect2 T C 3: 27,126,963 K581E probably damaging Het
Edem1 C T 6: 108,841,697 T222M probably damaging Het
Eif2ak1 A G 5: 143,901,803 M592V probably damaging Het
Endou T G 15: 97,726,539 D49A probably damaging Het
Ensa A G 3: 95,622,554 probably benign Het
Evc2 G T 5: 37,387,031 R708L probably damaging Het
Fam120b T A 17: 15,422,962 C668S probably damaging Het
Fam135a A T 1: 24,028,754 C798* probably null Het
Fam135b T C 15: 71,462,951 D798G probably benign Het
Fam208a A T 14: 27,461,095 I504L probably benign Het
Fshb A C 2: 107,057,282 *131E probably null Het
G3bp2 C T 5: 92,054,909 V441M possibly damaging Het
Galnt6 A T 15: 100,699,224 F354I probably damaging Het
Gm1123 C A 9: 99,023,240 probably null Het
Gm1123 A T 9: 99,023,241 probably null Het
Gm15130 T C 2: 111,142,862 N115S unknown Het
Gm7104 A G 12: 88,285,995 noncoding transcript Het
Gm9762 A T 3: 78,966,421 noncoding transcript Het
Grip2 A G 6: 91,779,182 V508A probably damaging Het
Grip2 T C 6: 91,779,192 T505A probably damaging Het
Haus4 A G 14: 54,549,892 probably null Het
Herc1 T A 9: 66,501,206 D4571E probably benign Het
Hnrnpk T A 13: 58,399,136 probably benign Het
Ica1l T C 1: 60,028,162 Y23C probably damaging Het
Kansl2-ps A G 7: 72,673,133 noncoding transcript Het
Kcnma1 T C 14: 23,363,836 D833G probably damaging Het
Kmt2e A T 5: 23,482,441 I430F possibly damaging Het
Mcpt1 T A 14: 56,018,680 F59I probably damaging Het
Mib2 G T 4: 155,655,365 T783K possibly damaging Het
Nlrp4g T C 9: 124,349,788 noncoding transcript Het
Obscn T C 11: 59,036,043 I6352V possibly damaging Het
Olfr1245 A T 2: 89,575,047 H226Q probably benign Het
Olfr1456-ps1 T A 19: 13,078,861 noncoding transcript Het
Olfr531 C T 7: 140,400,159 A296T probably damaging Het
Olfr68 T C 7: 103,777,668 I226V probably benign Het
Olfr728 T A 14: 50,140,033 N202I possibly damaging Het
Olfr728 T G 14: 50,140,034 N202H probably benign Het
Pcdh10 G A 3: 45,380,637 R462H probably damaging Het
Pcdhga12 C A 18: 37,766,551 N145K probably damaging Het
Pik3r6 T A 11: 68,544,775 L613Q probably damaging Het
Pknox2 T C 9: 36,909,720 D282G probably damaging Het
Plod2 T G 9: 92,606,531 Y624* probably null Het
Prkd3 C A 17: 78,956,614 V684F probably damaging Het
Ptpn1 T A 2: 167,974,160 V198D probably damaging Het
Ptpn12 G T 5: 20,998,589 P397Q probably benign Het
Rad1 C A 15: 10,493,126 probably benign Het
Rasl11a A G 5: 146,847,015 D90G probably benign Het
Rnf181 A G 6: 72,360,560 probably benign Het
Ryr3 T C 2: 112,757,639 I2652M possibly damaging Het
Siglecg C T 7: 43,411,871 probably benign Het
Slc22a3 T C 17: 12,507,195 S44G probably benign Het
Slc38a1 A T 15: 96,576,782 F463I probably damaging Het
Smg1 A T 7: 118,156,731 probably benign Het
Syk T C 13: 52,612,259 probably benign Het
Tbc1d5 T C 17: 50,800,165 I454M probably benign Het
Tmed6 C A 8: 107,063,730 D146Y probably damaging Het
Tmem132e A T 11: 82,444,851 K828* probably null Het
Tmprss15 A T 16: 79,054,124 S294T probably damaging Het
Trp53bp1 A G 2: 121,207,879 S1493P probably damaging Het
Tshb A T 3: 102,778,175 I46N probably damaging Het
Tspan11 T C 6: 127,938,220 V99A probably benign Het
Ttn T C 2: 76,715,561 T24176A probably benign Het
Vmn1r8 T C 6: 57,035,967 M1T probably null Het
Vmn2r104 A T 17: 20,040,768 Y464* probably null Het
Vmn2r110 T C 17: 20,596,196 T22A probably benign Het
Vmn2r17 T A 5: 109,452,849 I671K probably damaging Het
Zbtb21 T C 16: 97,951,266 N606D probably damaging Het
Zfy2 A T Y: 2,121,477 S139T probably benign Het
Zkscan17 G A 11: 59,503,025 R156* probably null Het
Zp2 A G 7: 120,138,318 V248A probably benign Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGAGTGATCTACGTGTAATTGACTC -3'
(R):5'- TATTTGCAGGGCAGCAGAAG -3'

Sequencing Primer
(F):5'- GACAGACAGACAGACAGTTTTGTTTC -3'
(R):5'- AGGCCTTCTGAAGAGAGTAAAC -3'
Posted On2015-11-11