Incidental Mutation 'R4754:Syk'
ID357837
Institutional Source Beutler Lab
Gene Symbol Syk
Ensembl Gene ENSMUSG00000021457
Gene Namespleen tyrosine kinase
SynonymsSykb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4754 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location52583173-52648792 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 52612259 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055087] [ENSMUST00000118756] [ENSMUST00000120135]
PDB Structure
Solution structure of the Vav1 SH2 domain complexed with a Syk-derived doubly phosphorylated peptide [SOLUTION NMR]
Solution structure of the Vav1 SH2 domain complexed with a Syk-derived singly phosphorylated peptide [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055087
SMART Domains Protein: ENSMUSP00000060828
Gene: ENSMUSG00000021457

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118756
SMART Domains Protein: ENSMUSP00000112914
Gene: ENSMUSG00000021457

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 342 582 2.68e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120135
SMART Domains Protein: ENSMUSP00000113852
Gene: ENSMUSG00000021457

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150672
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,393 F151L probably benign Het
4932438A13Rik C T 3: 37,022,466 Q3663* probably null Het
A130010J15Rik A G 1: 193,174,529 Y63C probably damaging Het
Abcb4 C A 5: 8,910,717 F266L probably damaging Het
Adam8 A T 7: 139,984,780 I681N possibly damaging Het
Adgrf3 T A 5: 30,197,617 probably null Het
Ang2 A G 14: 51,195,517 V136A probably damaging Het
Ankar C T 1: 72,698,694 G110R probably damaging Het
Ap3b1 T C 13: 94,403,960 L130P probably damaging Het
Apc2 T G 10: 80,314,358 W1749G probably benign Het
Asb2 T C 12: 103,323,837 N565S possibly damaging Het
B3gnt7 C A 1: 86,305,557 T58K probably benign Het
Brpf1 T A 6: 113,320,447 N876K possibly damaging Het
Ccdc157 T C 11: 4,148,994 I69V possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh20 A T 1: 104,984,685 I555F probably damaging Het
Cfap73 T C 5: 120,629,664 D274G probably damaging Het
Chd5 T A 4: 152,377,746 I1310N probably damaging Het
Ckap2 T A 8: 22,168,895 I611F possibly damaging Het
Cpeb2 A G 5: 43,285,857 I964V possibly damaging Het
Ctbp2 C A 7: 133,023,558 probably null Het
Dhrs2 A T 14: 55,238,748 I142F probably damaging Het
Dnah5 T A 15: 28,420,955 probably null Het
Dst T C 1: 34,212,309 S1822P probably damaging Het
Ect2 T C 3: 27,126,963 K581E probably damaging Het
Edem1 C T 6: 108,841,697 T222M probably damaging Het
Eif2ak1 A G 5: 143,901,803 M592V probably damaging Het
Endou T G 15: 97,726,539 D49A probably damaging Het
Ensa A G 3: 95,622,554 probably benign Het
Evc2 G T 5: 37,387,031 R708L probably damaging Het
Fam120b T A 17: 15,422,962 C668S probably damaging Het
Fam135a A T 1: 24,028,754 C798* probably null Het
Fam135b T C 15: 71,462,951 D798G probably benign Het
Fam208a A T 14: 27,461,095 I504L probably benign Het
Fshb A C 2: 107,057,282 *131E probably null Het
G3bp2 C T 5: 92,054,909 V441M possibly damaging Het
Galnt6 A T 15: 100,699,224 F354I probably damaging Het
Gm1123 C A 9: 99,023,240 probably null Het
Gm1123 A T 9: 99,023,241 probably null Het
Gm15130 T C 2: 111,142,862 N115S unknown Het
Gm7104 A G 12: 88,285,995 noncoding transcript Het
Gm9762 A T 3: 78,966,421 noncoding transcript Het
Grip2 A G 6: 91,779,182 V508A probably damaging Het
Grip2 T C 6: 91,779,192 T505A probably damaging Het
Haus4 A G 14: 54,549,892 probably null Het
Herc1 T A 9: 66,501,206 D4571E probably benign Het
Hnrnpk T A 13: 58,399,136 probably benign Het
Ica1l T C 1: 60,028,162 Y23C probably damaging Het
Kansl2-ps A G 7: 72,673,133 noncoding transcript Het
Kcnma1 T C 14: 23,363,836 D833G probably damaging Het
Kmt2e A T 5: 23,482,441 I430F possibly damaging Het
Lama2 C A 10: 27,118,531 R1794L possibly damaging Het
Mcpt1 T A 14: 56,018,680 F59I probably damaging Het
Mib2 G T 4: 155,655,365 T783K possibly damaging Het
Nlrp4g T C 9: 124,349,788 noncoding transcript Het
Obscn T C 11: 59,036,043 I6352V possibly damaging Het
Olfr1245 A T 2: 89,575,047 H226Q probably benign Het
Olfr1456-ps1 T A 19: 13,078,861 noncoding transcript Het
Olfr531 C T 7: 140,400,159 A296T probably damaging Het
Olfr68 T C 7: 103,777,668 I226V probably benign Het
Olfr728 T A 14: 50,140,033 N202I possibly damaging Het
Olfr728 T G 14: 50,140,034 N202H probably benign Het
Pcdh10 G A 3: 45,380,637 R462H probably damaging Het
Pcdhga12 C A 18: 37,766,551 N145K probably damaging Het
Pik3r6 T A 11: 68,544,775 L613Q probably damaging Het
Pknox2 T C 9: 36,909,720 D282G probably damaging Het
Plod2 T G 9: 92,606,531 Y624* probably null Het
Prkd3 C A 17: 78,956,614 V684F probably damaging Het
Ptpn1 T A 2: 167,974,160 V198D probably damaging Het
Ptpn12 G T 5: 20,998,589 P397Q probably benign Het
Rad1 C A 15: 10,493,126 probably benign Het
Rasl11a A G 5: 146,847,015 D90G probably benign Het
Rnf181 A G 6: 72,360,560 probably benign Het
Ryr3 T C 2: 112,757,639 I2652M possibly damaging Het
Siglecg C T 7: 43,411,871 probably benign Het
Slc22a3 T C 17: 12,507,195 S44G probably benign Het
Slc38a1 A T 15: 96,576,782 F463I probably damaging Het
Smg1 A T 7: 118,156,731 probably benign Het
Tbc1d5 T C 17: 50,800,165 I454M probably benign Het
Tmed6 C A 8: 107,063,730 D146Y probably damaging Het
Tmem132e A T 11: 82,444,851 K828* probably null Het
Tmprss15 A T 16: 79,054,124 S294T probably damaging Het
Trp53bp1 A G 2: 121,207,879 S1493P probably damaging Het
Tshb A T 3: 102,778,175 I46N probably damaging Het
Tspan11 T C 6: 127,938,220 V99A probably benign Het
Ttn T C 2: 76,715,561 T24176A probably benign Het
Vmn1r8 T C 6: 57,035,967 M1T probably null Het
Vmn2r104 A T 17: 20,040,768 Y464* probably null Het
Vmn2r110 T C 17: 20,596,196 T22A probably benign Het
Vmn2r17 T A 5: 109,452,849 I671K probably damaging Het
Zbtb21 T C 16: 97,951,266 N606D probably damaging Het
Zfy2 A T Y: 2,121,477 S139T probably benign Het
Zkscan17 G A 11: 59,503,025 R156* probably null Het
Zp2 A G 7: 120,138,318 V248A probably benign Het
Other mutations in Syk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Syk APN 13 52624748 missense probably benign 0.00
IGL01522:Syk APN 13 52643061 missense probably benign
IGL01957:Syk APN 13 52631740 missense probably benign
IGL01962:Syk APN 13 52610957 missense probably damaging 1.00
IGL02613:Syk APN 13 52643040 missense probably damaging 0.97
IGL02824:Syk APN 13 52623283 splice site probably benign
IGL03130:Syk APN 13 52622732 missense probably benign 0.12
Apricot UTSW 13 52640733 missense probably damaging 1.00
poppy UTSW 13 52640733 missense probably damaging 1.00
Sisyphus UTSW 13 52640790 missense probably damaging 1.00
H8562:Syk UTSW 13 52640621 missense probably damaging 1.00
R0091:Syk UTSW 13 52640733 missense probably damaging 1.00
R0346:Syk UTSW 13 52640659 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1917:Syk UTSW 13 52622708 missense probably damaging 1.00
R2001:Syk UTSW 13 52611238 missense probably benign 0.21
R2919:Syk UTSW 13 52611121 missense probably benign
R3413:Syk UTSW 13 52631739 missense probably benign
R3695:Syk UTSW 13 52622765 splice site probably null
R4363:Syk UTSW 13 52640730 missense probably damaging 1.00
R4755:Syk UTSW 13 52641986 missense probably benign 0.25
R4806:Syk UTSW 13 52632927 missense probably benign 0.14
R4817:Syk UTSW 13 52611206 missense probably benign 0.03
R4903:Syk UTSW 13 52611081 missense probably damaging 1.00
R4997:Syk UTSW 13 52612448 nonsense probably null
R5066:Syk UTSW 13 52641982 missense possibly damaging 0.49
R5114:Syk UTSW 13 52611035 missense probably damaging 1.00
R5267:Syk UTSW 13 52641926 missense probably benign 0.05
R5323:Syk UTSW 13 52631717 missense probably benign 0.00
R5705:Syk UTSW 13 52611047 missense probably benign 0.03
R6190:Syk UTSW 13 52611053 missense probably damaging 0.97
R6892:Syk UTSW 13 52632898 missense probably benign 0.00
R6932:Syk UTSW 13 52612459 splice site probably null
R6977:Syk UTSW 13 52633058 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTATGGCTTTTCAAGGGCC -3'
(R):5'- GGAGATGGCTTGTCACTCAC -3'

Sequencing Primer
(F):5'- GGCTTTTCAAGGGCCCATCTC -3'
(R):5'- GTCTTTGACCCTATGAGGACCG -3'
Posted On2015-11-11