Incidental Mutation 'R4755:Slc25a39'
ID357943
Institutional Source Beutler Lab
Gene Symbol Slc25a39
Ensembl Gene ENSMUSG00000018677
Gene Namesolute carrier family 25, member 39
SynonymsD11Ertd333e, 3010027G13Rik
MMRRC Submission 042033-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R4755 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102402985-102407946 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 102406666 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006750] [ENSMUST00000018821] [ENSMUST00000107098] [ENSMUST00000107102] [ENSMUST00000107103] [ENSMUST00000107105] [ENSMUST00000124755] [ENSMUST00000130436] [ENSMUST00000134669] [ENSMUST00000142097] [ENSMUST00000149777] [ENSMUST00000154001] [ENSMUST00000155104]
Predicted Effect probably benign
Transcript: ENSMUST00000006750
SMART Domains Protein: ENSMUSP00000006750
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018821
SMART Domains Protein: ENSMUSP00000018821
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 156 6.9e-23 PFAM
Pfam:Mito_carr 158 247 6.1e-19 PFAM
Pfam:Mito_carr 251 352 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107098
SMART Domains Protein: ENSMUSP00000102715
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 148 1.4e-21 PFAM
Pfam:Mito_carr 150 240 3.7e-19 PFAM
Pfam:Mito_carr 243 344 4.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107102
SMART Domains Protein: ENSMUSP00000102719
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107103
SMART Domains Protein: ENSMUSP00000102720
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 120 182 2.34e-19 SMART
coiled coil region 262 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107105
SMART Domains Protein: ENSMUSP00000102722
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123688
Predicted Effect probably benign
Transcript: ENSMUST00000124755
SMART Domains Protein: ENSMUSP00000120021
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 71 1.3e-9 PFAM
Pfam:Mito_carr 92 152 9.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128825
SMART Domains Protein: ENSMUSP00000121790
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 35 77 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130436
SMART Domains Protein: ENSMUSP00000115087
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 1.8e-9 PFAM
Pfam:Mito_carr 92 156 5.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131219
Predicted Effect probably benign
Transcript: ENSMUST00000134669
SMART Domains Protein: ENSMUSP00000114481
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 1.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141535
Predicted Effect probably benign
Transcript: ENSMUST00000142097
SMART Domains Protein: ENSMUSP00000114365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 63 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147860
Predicted Effect probably benign
Transcript: ENSMUST00000149777
SMART Domains Protein: ENSMUSP00000115365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 2.7e-9 PFAM
Pfam:Mito_carr 92 156 8.7e-15 PFAM
Pfam:Mito_carr 158 220 6.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153395
Predicted Effect probably benign
Transcript: ENSMUST00000154001
SMART Domains Protein: ENSMUSP00000116336
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 3.1e-10 PFAM
Pfam:Mito_carr 92 156 9.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155104
SMART Domains Protein: ENSMUSP00000115445
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 3.7e-9 PFAM
Pfam:Mito_carr 92 156 1.2e-14 PFAM
Pfam:Mito_carr 158 248 5.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183859
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC25 transporter or mitochondrial carrier family of proteins. Members of this family are encoded by the nuclear genome while their protein products are usually embedded in the inner mitochondrial membrane and exhibit wide-ranging substrate specificity. Although the encoded protein is currently considered an orphan transporter, this protein is related to other carriers known to transport amino acids. This protein may play a role in iron homeostasis. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,859 noncoding transcript Het
Accs T C 2: 93,841,337 E236G probably damaging Het
Agrn C T 4: 156,173,522 probably benign Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Akap5 C A 12: 76,327,807 C4* probably null Het
Amotl2 A T 9: 102,720,480 H146L probably damaging Het
Ank1 A G 8: 23,104,974 N666S probably damaging Het
Atp10d A T 5: 72,246,166 T373S probably benign Het
Bpifb9b T A 2: 154,319,694 M582K probably benign Het
Brca2 T A 5: 150,559,987 probably null Het
C130079G13Rik C T 3: 59,936,314 A143V probably benign Het
C330021F23Rik A T 8: 3,583,922 S8C probably damaging Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdk5rap2 A G 4: 70,238,425 S1617P probably damaging Het
Cenpk A T 13: 104,230,871 M37L probably benign Het
Cenpk A T 13: 104,249,512 H305L probably benign Het
Ces5a C A 8: 93,535,677 A11S probably benign Het
Cfap65 T C 1: 74,928,361 E186G probably damaging Het
Cfh T A 1: 140,088,808 I593F probably damaging Het
Clstn2 C T 9: 97,445,673 V961I probably benign Het
Cog5 T A 12: 31,869,406 probably null Het
Col4a4 T C 1: 82,541,174 D100G unknown Het
Cyp3a41a T C 5: 145,715,506 D61G probably damaging Het
Dnah10 A G 5: 124,747,745 N655S probably benign Het
Dnaic1 C G 4: 41,610,269 T295R probably damaging Het
Dnajc6 C T 4: 101,550,799 A44V probably damaging Het
Eif4enif1 A T 11: 3,244,016 D960V probably damaging Het
Fam167b C T 4: 129,578,342 G12R probably damaging Het
Fam20b A T 1: 156,687,496 Y266* probably null Het
Fer1l6 T A 15: 58,640,211 V1509D probably benign Het
Fhad1 A T 4: 141,928,483 I105N probably damaging Het
Fmo2 T C 1: 162,888,805 D71G probably damaging Het
Folr2 T C 7: 101,843,799 T6A possibly damaging Het
Fry A C 5: 150,398,254 E1018A probably damaging Het
Gas2l2 A G 11: 83,429,367 I21T probably damaging Het
Gfra1 T C 19: 58,453,244 Y85C probably damaging Het
Gm9117 T C 3: 93,938,786 probably null Het
Gpld1 A T 13: 24,979,688 Y43F probably benign Het
Gpld1 T A 13: 24,979,692 Y44* probably null Het
Grid2 A G 6: 63,908,988 T123A probably benign Het
Grina T C 15: 76,249,242 L305P probably damaging Het
Gucy1a1 G A 3: 82,094,795 A659V probably benign Het
H2-T10 T A 17: 36,118,945 K319* probably null Het
Hey2 A T 10: 30,834,304 V151E probably benign Het
Ighv1-69 G A 12: 115,623,558 T13I probably benign Het
Il1rap C A 16: 26,722,782 A591E probably benign Het
Ildr1 T C 16: 36,722,021 L261P probably benign Het
Jak1 A G 4: 101,174,157 Y463H probably damaging Het
Lrp1b T C 2: 41,269,273 I1666V probably benign Het
Lrp1b T A 2: 41,471,016 T592S probably benign Het
Lrrc36 A G 8: 105,452,144 T445A possibly damaging Het
Ly9 G A 1: 171,607,238 S29F probably damaging Het
Mapk7 A C 11: 61,490,843 C32W probably damaging Het
March10 C T 11: 105,364,476 probably benign Het
Mier2 A T 10: 79,549,197 M119K probably damaging Het
Mpv17 A T 5: 31,145,982 C59* probably null Het
Mrpl27 G A 11: 94,653,833 probably benign Het
Myo18b G A 5: 112,874,474 Q351* probably null Het
Myo1a A G 10: 127,715,688 I704M probably damaging Het
Nadsyn1 A G 7: 143,806,913 C373R probably damaging Het
Nckipsd C A 9: 108,814,739 A513E probably benign Het
Neb T C 2: 52,220,209 D209G probably damaging Het
Nkapl T A 13: 21,468,287 Q52L unknown Het
Nptx2 G A 5: 144,546,440 S126N probably benign Het
Olfr13 G A 6: 43,174,043 S19N probably benign Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Olfr829 A T 9: 18,857,180 H185L probably benign Het
Olfr917 A G 9: 38,665,832 V4A probably benign Het
Pclo A T 5: 14,714,348 R4278S unknown Het
Pcnx T G 12: 81,950,294 L988R probably damaging Het
Prl2c5 C A 13: 13,189,385 N75K probably benign Het
Prpf19 T G 19: 10,897,790 probably benign Het
Ralgapa1 A G 12: 55,712,748 S997P probably damaging Het
Rangap1 T C 15: 81,712,917 T226A probably benign Het
Rimklb G A 6: 122,456,406 L262F probably damaging Het
Rnf169 A G 7: 99,925,723 M555T probably benign Het
Rp1l1 A T 14: 64,030,070 D1035V probably benign Het
Scd2 T A 19: 44,301,352 L262Q probably damaging Het
Scgb2b12 T A 7: 32,325,531 M84L probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G A 12: 82,372,386 V613I possibly damaging Het
Slc25a23 T A 17: 57,052,794 D67V possibly damaging Het
Slc4a10 T A 2: 62,296,988 F895Y probably damaging Het
Slc5a4a A C 10: 76,186,564 K578Q probably benign Het
Slc6a13 G A 6: 121,325,049 G197S probably damaging Het
Smarca2 A T 19: 26,654,483 E566V possibly damaging Het
Sorbs3 A T 14: 70,184,099 N594K probably benign Het
Spata22 A T 11: 73,345,756 D296V probably damaging Het
Sphk2 G A 7: 45,713,634 A11V possibly damaging Het
Spp1 A T 5: 104,435,215 probably benign Het
Strn3 T A 12: 51,610,216 I760L possibly damaging Het
Syk A T 13: 52,641,986 Y539F probably benign Het
Thsd7b T A 1: 130,210,264 Y1560N probably benign Het
Tmod2 C A 9: 75,597,212 E42* probably null Het
Tom1l1 T C 11: 90,685,116 E30G probably damaging Het
Trav10 G A 14: 53,506,061 A40T probably benign Het
Trav14-2 G A 14: 53,640,780 probably benign Het
Tril T A 6: 53,818,464 E591V probably damaging Het
Trp53bp1 T A 2: 121,228,606 R179* probably null Het
Tspoap1 A T 11: 87,771,663 D562V possibly damaging Het
Usp44 A T 10: 93,846,906 H406L probably damaging Het
Vangl1 A G 3: 102,158,292 I509T probably benign Het
Vax2 T G 6: 83,711,397 L34W probably damaging Het
Vmn1r55 A T 7: 5,147,026 C133S probably damaging Het
Vmn2r8 T A 5: 108,801,700 D427V probably benign Het
Vwde A G 6: 13,205,852 I232T possibly damaging Het
Wnk1 C A 6: 119,963,470 A769S probably damaging Het
Xpo4 A C 14: 57,618,181 S264A probably benign Het
Zfp330 A T 8: 82,769,386 C75* probably null Het
Zfp526 T A 7: 25,225,639 L441Q probably benign Het
Zfp607b T G 7: 27,703,505 L462R probably damaging Het
Zfp719 T A 7: 43,590,793 F602I probably damaging Het
Other mutations in Slc25a39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Slc25a39 APN 11 102404900 missense probably damaging 1.00
IGL01601:Slc25a39 APN 11 102405718 missense probably damaging 1.00
IGL02734:Slc25a39 APN 11 102404523 missense probably benign 0.03
IGL03382:Slc25a39 APN 11 102406204 critical splice donor site probably null
R0218:Slc25a39 UTSW 11 102406230 missense probably benign 0.00
R0359:Slc25a39 UTSW 11 102406569 missense possibly damaging 0.88
R0939:Slc25a39 UTSW 11 102405051 missense probably damaging 1.00
R1702:Slc25a39 UTSW 11 102406626 missense possibly damaging 0.68
R2047:Slc25a39 UTSW 11 102405831 splice site probably benign
R2367:Slc25a39 UTSW 11 102403651 missense possibly damaging 0.52
R4018:Slc25a39 UTSW 11 102405024 missense probably damaging 1.00
R4878:Slc25a39 UTSW 11 102403675 missense probably benign 0.06
R5629:Slc25a39 UTSW 11 102404893 nonsense probably null
R5704:Slc25a39 UTSW 11 102403394 unclassified probably benign
R6092:Slc25a39 UTSW 11 102404893 nonsense probably null
R6502:Slc25a39 UTSW 11 102404460 missense probably damaging 0.99
R6955:Slc25a39 UTSW 11 102403518 missense probably benign 0.00
R6980:Slc25a39 UTSW 11 102405775 missense probably damaging 0.99
Predicted Primers
Posted On2015-11-11