Incidental Mutation 'R4755:Gfra1'
ID357974
Institutional Source Beutler Lab
Gene Symbol Gfra1
Ensembl Gene ENSMUSG00000025089
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 1
SynonymsGDNFR-alpha, GFR alpha-1
MMRRC Submission 042033-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4755 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location58235604-58455909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58453244 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 85 (Y85C)
Ref Sequence ENSEMBL: ENSMUSP00000130128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026076] [ENSMUST00000123957] [ENSMUST00000129100] [ENSMUST00000131877] [ENSMUST00000135730] [ENSMUST00000138530] [ENSMUST00000140141] [ENSMUST00000152507] [ENSMUST00000169850]
Predicted Effect probably damaging
Transcript: ENSMUST00000026076
AA Change: Y85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026076
Gene: ENSMUSG00000025089
AA Change: Y85C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123957
Predicted Effect probably damaging
Transcript: ENSMUST00000129100
AA Change: Y85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117196
Gene: ENSMUSG00000025089
AA Change: Y85C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 149 228 6.55e-24 SMART
GDNF 238 332 1.62e-28 SMART
low complexity region 357 365 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131877
Predicted Effect probably benign
Transcript: ENSMUST00000135730
Predicted Effect probably benign
Transcript: ENSMUST00000138530
SMART Domains Protein: ENSMUSP00000115239
Gene: ENSMUSG00000025089

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:GDNF 29 54 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000140141
AA Change: Y85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123022
Gene: ENSMUSG00000025089
AA Change: Y85C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152507
AA Change: Y85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120333
Gene: ENSMUSG00000025089
AA Change: Y85C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169850
AA Change: Y85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130128
Gene: ENSMUSG00000025089
AA Change: Y85C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that functions as the receptor for glial cell line derived neurotrophic factor (GDNF). The encoded protein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-anchored cell surface coreceptor that forms a complex with the Ret tyrosine kinase in GDNF signaling pathway. Mice lacking the encoded protein exhibit deficits in the kidneys, the enteric nervous system, and spinal motor and sensory neurons similar mice deficient in GDNF or Ret. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack kidneys and enteric neurons resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,859 noncoding transcript Het
Accs T C 2: 93,841,337 E236G probably damaging Het
Agrn C T 4: 156,173,522 probably benign Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Akap5 C A 12: 76,327,807 C4* probably null Het
Amotl2 A T 9: 102,720,480 H146L probably damaging Het
Ank1 A G 8: 23,104,974 N666S probably damaging Het
Atp10d A T 5: 72,246,166 T373S probably benign Het
Bpifb9b T A 2: 154,319,694 M582K probably benign Het
Brca2 T A 5: 150,559,987 probably null Het
C130079G13Rik C T 3: 59,936,314 A143V probably benign Het
C330021F23Rik A T 8: 3,583,922 S8C probably damaging Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdk5rap2 A G 4: 70,238,425 S1617P probably damaging Het
Cenpk A T 13: 104,230,871 M37L probably benign Het
Cenpk A T 13: 104,249,512 H305L probably benign Het
Ces5a C A 8: 93,535,677 A11S probably benign Het
Cfap65 T C 1: 74,928,361 E186G probably damaging Het
Cfh T A 1: 140,088,808 I593F probably damaging Het
Clstn2 C T 9: 97,445,673 V961I probably benign Het
Cog5 T A 12: 31,869,406 probably null Het
Col4a4 T C 1: 82,541,174 D100G unknown Het
Cyp3a41a T C 5: 145,715,506 D61G probably damaging Het
Dnah10 A G 5: 124,747,745 N655S probably benign Het
Dnaic1 C G 4: 41,610,269 T295R probably damaging Het
Dnajc6 C T 4: 101,550,799 A44V probably damaging Het
Eif4enif1 A T 11: 3,244,016 D960V probably damaging Het
Fam167b C T 4: 129,578,342 G12R probably damaging Het
Fam20b A T 1: 156,687,496 Y266* probably null Het
Fer1l6 T A 15: 58,640,211 V1509D probably benign Het
Fhad1 A T 4: 141,928,483 I105N probably damaging Het
Fmo2 T C 1: 162,888,805 D71G probably damaging Het
Folr2 T C 7: 101,843,799 T6A possibly damaging Het
Fry A C 5: 150,398,254 E1018A probably damaging Het
Gas2l2 A G 11: 83,429,367 I21T probably damaging Het
Gm9117 T C 3: 93,938,786 probably null Het
Gpld1 A T 13: 24,979,688 Y43F probably benign Het
Gpld1 T A 13: 24,979,692 Y44* probably null Het
Grid2 A G 6: 63,908,988 T123A probably benign Het
Grina T C 15: 76,249,242 L305P probably damaging Het
Gucy1a1 G A 3: 82,094,795 A659V probably benign Het
H2-T10 T A 17: 36,118,945 K319* probably null Het
Hey2 A T 10: 30,834,304 V151E probably benign Het
Ighv1-69 G A 12: 115,623,558 T13I probably benign Het
Il1rap C A 16: 26,722,782 A591E probably benign Het
Ildr1 T C 16: 36,722,021 L261P probably benign Het
Jak1 A G 4: 101,174,157 Y463H probably damaging Het
Lrp1b T C 2: 41,269,273 I1666V probably benign Het
Lrp1b T A 2: 41,471,016 T592S probably benign Het
Lrrc36 A G 8: 105,452,144 T445A possibly damaging Het
Ly9 G A 1: 171,607,238 S29F probably damaging Het
Mapk7 A C 11: 61,490,843 C32W probably damaging Het
March10 C T 11: 105,364,476 probably benign Het
Mier2 A T 10: 79,549,197 M119K probably damaging Het
Mpv17 A T 5: 31,145,982 C59* probably null Het
Mrpl27 G A 11: 94,653,833 probably benign Het
Myo18b G A 5: 112,874,474 Q351* probably null Het
Myo1a A G 10: 127,715,688 I704M probably damaging Het
Nadsyn1 A G 7: 143,806,913 C373R probably damaging Het
Nckipsd C A 9: 108,814,739 A513E probably benign Het
Neb T C 2: 52,220,209 D209G probably damaging Het
Nkapl T A 13: 21,468,287 Q52L unknown Het
Nptx2 G A 5: 144,546,440 S126N probably benign Het
Olfr13 G A 6: 43,174,043 S19N probably benign Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Olfr829 A T 9: 18,857,180 H185L probably benign Het
Olfr917 A G 9: 38,665,832 V4A probably benign Het
Pclo A T 5: 14,714,348 R4278S unknown Het
Pcnx T G 12: 81,950,294 L988R probably damaging Het
Prl2c5 C A 13: 13,189,385 N75K probably benign Het
Prpf19 T G 19: 10,897,790 probably benign Het
Ralgapa1 A G 12: 55,712,748 S997P probably damaging Het
Rangap1 T C 15: 81,712,917 T226A probably benign Het
Rimklb G A 6: 122,456,406 L262F probably damaging Het
Rnf169 A G 7: 99,925,723 M555T probably benign Het
Rp1l1 A T 14: 64,030,070 D1035V probably benign Het
Scd2 T A 19: 44,301,352 L262Q probably damaging Het
Scgb2b12 T A 7: 32,325,531 M84L probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G A 12: 82,372,386 V613I possibly damaging Het
Slc25a23 T A 17: 57,052,794 D67V possibly damaging Het
Slc25a39 C T 11: 102,406,666 probably benign Het
Slc4a10 T A 2: 62,296,988 F895Y probably damaging Het
Slc5a4a A C 10: 76,186,564 K578Q probably benign Het
Slc6a13 G A 6: 121,325,049 G197S probably damaging Het
Smarca2 A T 19: 26,654,483 E566V possibly damaging Het
Sorbs3 A T 14: 70,184,099 N594K probably benign Het
Spata22 A T 11: 73,345,756 D296V probably damaging Het
Sphk2 G A 7: 45,713,634 A11V possibly damaging Het
Spp1 A T 5: 104,435,215 probably benign Het
Strn3 T A 12: 51,610,216 I760L possibly damaging Het
Syk A T 13: 52,641,986 Y539F probably benign Het
Thsd7b T A 1: 130,210,264 Y1560N probably benign Het
Tmod2 C A 9: 75,597,212 E42* probably null Het
Tom1l1 T C 11: 90,685,116 E30G probably damaging Het
Trav10 G A 14: 53,506,061 A40T probably benign Het
Trav14-2 G A 14: 53,640,780 probably benign Het
Tril T A 6: 53,818,464 E591V probably damaging Het
Trp53bp1 T A 2: 121,228,606 R179* probably null Het
Tspoap1 A T 11: 87,771,663 D562V possibly damaging Het
Usp44 A T 10: 93,846,906 H406L probably damaging Het
Vangl1 A G 3: 102,158,292 I509T probably benign Het
Vax2 T G 6: 83,711,397 L34W probably damaging Het
Vmn1r55 A T 7: 5,147,026 C133S probably damaging Het
Vmn2r8 T A 5: 108,801,700 D427V probably benign Het
Vwde A G 6: 13,205,852 I232T possibly damaging Het
Wnk1 C A 6: 119,963,470 A769S probably damaging Het
Xpo4 A C 14: 57,618,181 S264A probably benign Het
Zfp330 A T 8: 82,769,386 C75* probably null Het
Zfp526 T A 7: 25,225,639 L441Q probably benign Het
Zfp607b T G 7: 27,703,505 L462R probably damaging Het
Zfp719 T A 7: 43,590,793 F602I probably damaging Het
Other mutations in Gfra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Gfra1 APN 19 58263905 splice site probably benign
IGL01633:Gfra1 APN 19 58267047 missense probably benign 0.41
IGL02675:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02676:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02677:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02723:Gfra1 APN 19 58453251 missense probably benign 0.00
3-1:Gfra1 UTSW 19 58298567 intron probably benign
R0245:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0652:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0697:Gfra1 UTSW 19 58270123 missense probably benign
R0699:Gfra1 UTSW 19 58270123 missense probably benign
R1344:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1418:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R2001:Gfra1 UTSW 19 58300275 missense probably damaging 1.00
R2866:Gfra1 UTSW 19 58239307 missense possibly damaging 0.93
R3416:Gfra1 UTSW 19 58267112 missense probably damaging 1.00
R4352:Gfra1 UTSW 19 58267024 missense probably benign 0.08
R4564:Gfra1 UTSW 19 58239250 splice site probably null
R4727:Gfra1 UTSW 19 58263954 missense probably damaging 0.96
R4914:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4915:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4917:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R5813:Gfra1 UTSW 19 58239255 missense probably benign
R6225:Gfra1 UTSW 19 58238398 missense probably damaging 1.00
R7023:Gfra1 UTSW 19 58454332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGCCAATGAAAGGTCCTC -3'
(R):5'- TGTGTGAAAGCCAGTGATCAG -3'

Sequencing Primer
(F):5'- TGAAAGGTCCTCATTCCGCAG -3'
(R):5'- AAGCCAGTGATCAGTGCCTG -3'
Posted On2015-11-11