Incidental Mutation 'R4741:Clip2'
ID358070
Institutional Source Beutler Lab
Gene Symbol Clip2
Ensembl Gene ENSMUSG00000063146
Gene NameCAP-GLY domain containing linker protein 2
SynonymsWSCR4, Cyln2, CLIP-115
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R4741 (G1)
Quality Score166
Status Not validated
Chromosome5
Chromosomal Location134489383-134552434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134516269 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 344 (T344S)
Ref Sequence ENSEMBL: ENSMUSP00000098212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]
Predicted Effect probably benign
Transcript: ENSMUST00000036999
AA Change: T344S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: T344S

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 457 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
coiled coil region 529 578 N/A INTRINSIC
coiled coil region 640 982 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100647
AA Change: T344S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: T344S

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 496 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
coiled coil region 564 613 N/A INTRINSIC
coiled coil region 675 1017 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202895
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Clip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Clip2 APN 5 134500157 splice site probably benign
IGL01024:Clip2 APN 5 134510212 missense probably damaging 1.00
IGL01103:Clip2 APN 5 134492350 missense possibly damaging 0.64
IGL01726:Clip2 APN 5 134522664 missense probably damaging 1.00
IGL01833:Clip2 APN 5 134498084 splice site probably benign
IGL02174:Clip2 APN 5 134494264 missense probably damaging 1.00
IGL02232:Clip2 APN 5 134503130 missense probably damaging 1.00
IGL02271:Clip2 APN 5 134502571 missense probably benign 0.35
IGL02471:Clip2 APN 5 134518022 missense probably benign 0.04
IGL02690:Clip2 APN 5 134510159 splice site probably benign
IGL03198:Clip2 APN 5 134498082 splice site probably benign
IGL03269:Clip2 APN 5 134516894 missense probably damaging 1.00
R0335:Clip2 UTSW 5 134535215 start gained probably benign
R0422:Clip2 UTSW 5 134498113 missense probably benign 0.04
R0519:Clip2 UTSW 5 134516151 missense probably benign 0.01
R1169:Clip2 UTSW 5 134492250 missense probably benign 0.36
R1642:Clip2 UTSW 5 134503253 missense possibly damaging 0.89
R1718:Clip2 UTSW 5 134502929 nonsense probably null
R1822:Clip2 UTSW 5 134503227 missense probably benign 0.01
R1824:Clip2 UTSW 5 134503227 missense probably benign 0.01
R2011:Clip2 UTSW 5 134503115 missense probably damaging 1.00
R3106:Clip2 UTSW 5 134523064 missense probably benign 0.12
R3890:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3891:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3892:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R4134:Clip2 UTSW 5 134492253 missense probably benign 0.08
R4237:Clip2 UTSW 5 134535197 start gained probably benign
R4239:Clip2 UTSW 5 134535197 start gained probably benign
R4294:Clip2 UTSW 5 134492313 missense probably benign 0.09
R4450:Clip2 UTSW 5 134502953 missense possibly damaging 0.82
R5186:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5235:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5409:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5410:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5448:Clip2 UTSW 5 134514048 missense probably benign 0.01
R5900:Clip2 UTSW 5 134502779 missense possibly damaging 0.48
R6464:Clip2 UTSW 5 134491925 missense probably benign 0.00
X0062:Clip2 UTSW 5 134503136 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCTCATGCTGTGCCTTCAG -3'
(R):5'- CTGTTGAAGTCTGACTCTCAGCC -3'

Sequencing Primer
(F):5'- AGCAGGGCGATCTCCTTCTC -3'
(R):5'- GAATCAGCAATGACTTTAGGGCATCC -3'
Posted On2015-11-11