Incidental Mutation 'R4741:Hp'
ID358086
Institutional Source Beutler Lab
Gene Symbol Hp
Ensembl Gene ENSMUSG00000031722
Gene Namehaptoglobin
SynonymsHP-1, preHP2, zonulin
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location109575128-109579172 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 109575472 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 281 (C281*)
Ref Sequence ENSEMBL: ENSMUSP00000074436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034159] [ENSMUST00000074898] [ENSMUST00000178445]
Predicted Effect probably benign
Transcript: ENSMUST00000034159
SMART Domains Protein: ENSMUSP00000034159
Gene: ENSMUSG00000031723

DomainStartEndE-ValueType
Pfam:DIM1 4 136 1.6e-58 PFAM
Pfam:Thioredoxin 6 109 3.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000074898
AA Change: C281*
SMART Domains Protein: ENSMUSP00000074436
Gene: ENSMUSG00000031722
AA Change: C281*

DomainStartEndE-ValueType
CCP 33 86 2.9e0 SMART
Tryp_SPc 102 340 4.38e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178445
SMART Domains Protein: ENSMUSP00000137524
Gene: ENSMUSG00000031723

DomainStartEndE-ValueType
Pfam:DIM1 4 136 1.2e-58 PFAM
Pfam:Thioredoxin 6 110 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212918
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a plasma glycoprotein called haptoglobin that binds free hemoglobin. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta subunits that form a disulfide-linked tetrameric protein that plays an important role in the sequestration and clearance of extracorpuscular hemoglobin. Mice lacking the encoded protein exhibit stunted development of lymphoid organs associated with lower counts of mature T and B cells in the blood and secondary lymphoid compartments. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a null allele exhibit partial postnatal lethality, susceptibility to induced acute hemolysis, and altered renal iron loading during aging and after ischemic injury. Homozygotes for a knock-in allele show reduced cholesterol efflux and enhanced nephropathy in STZ-induced diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Hp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Hp APN 8 109575618 unclassified probably null
IGL00951:Hp APN 8 109577497 missense possibly damaging 0.71
IGL01013:Hp APN 8 109579021 utr 5 prime probably benign
IGL01096:Hp APN 8 109575401 missense probably benign
IGL01307:Hp APN 8 109575783 missense probably benign 0.05
IGL02997:Hp APN 8 109575786 missense probably damaging 1.00
IGL03378:Hp APN 8 109575707 missense probably damaging 0.99
R1349:Hp UTSW 8 109575306 missense probably benign 0.00
R1691:Hp UTSW 8 109575572 missense probably benign 0.09
R6036:Hp UTSW 8 109576774 unclassified probably null
R6036:Hp UTSW 8 109576774 unclassified probably null
R6689:Hp UTSW 8 109575720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAACCCAGTCCTTCAGGTC -3'
(R):5'- GAGTCATGCCTATCTGCCTG -3'

Sequencing Primer
(F):5'- AGTCCTTCAGGTCGGTCG -3'
(R):5'- TACATAGCACCAGGCCGTGTG -3'
Posted On2015-11-11