Incidental Mutation 'R4741:Taf1c'
ID358087
Institutional Source Beutler Lab
Gene Symbol Taf1c
Ensembl Gene ENSMUSG00000031832
Gene NameTATA-box binding protein associated factor, RNA polymerase I, C
SynonymsmTAFI95
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location119597871-119605222 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 119603395 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093099] [ENSMUST00000093100] [ENSMUST00000147964]
Predicted Effect unknown
Transcript: ENSMUST00000093099
AA Change: M70T
SMART Domains Protein: ENSMUSP00000090789
Gene: ENSMUSG00000031832
AA Change: M70T

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
SCOP:d1k32a3 253 389 2e-3 SMART
Blast:WD40 301 340 2e-15 BLAST
low complexity region 457 472 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093100
SMART Domains Protein: ENSMUSP00000090790
Gene: ENSMUSG00000031831

DomainStartEndE-ValueType
Pfam:LRR_9 115 298 5.7e-10 PFAM
low complexity region 322 332 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144379
Predicted Effect unknown
Transcript: ENSMUST00000147964
AA Change: M70T
SMART Domains Protein: ENSMUSP00000118480
Gene: ENSMUSG00000031832
AA Change: M70T

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212929
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Taf1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Taf1c APN 8 119601328 missense possibly damaging 0.80
IGL01098:Taf1c APN 8 119602841 missense probably damaging 0.98
IGL01287:Taf1c APN 8 119601192 missense probably benign 0.01
IGL02339:Taf1c APN 8 119604280 missense probably damaging 1.00
IGL02642:Taf1c APN 8 119599057 missense probably benign
IGL02954:Taf1c APN 8 119600486 missense probably damaging 1.00
R0026:Taf1c UTSW 8 119604236 splice site probably null
R0031:Taf1c UTSW 8 119599090 missense probably benign 0.00
R0087:Taf1c UTSW 8 119600987 missense probably damaging 1.00
R0197:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R0701:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R0883:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R2200:Taf1c UTSW 8 119598678 missense probably benign
R3726:Taf1c UTSW 8 119603070 missense probably damaging 1.00
R3765:Taf1c UTSW 8 119600485 nonsense probably null
R3916:Taf1c UTSW 8 119600505 missense probably damaging 1.00
R4368:Taf1c UTSW 8 119599316 missense possibly damaging 0.60
R4470:Taf1c UTSW 8 119599622 missense probably benign
R4501:Taf1c UTSW 8 119599429 missense probably damaging 1.00
R4661:Taf1c UTSW 8 119598850 missense probably damaging 0.99
R4938:Taf1c UTSW 8 119598798 missense probably benign 0.26
R5481:Taf1c UTSW 8 119599240 missense probably damaging 1.00
R6335:Taf1c UTSW 8 119601779 missense probably damaging 1.00
R6517:Taf1c UTSW 8 119604247 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- AGGAAGTCCTGAGCTGTCAC -3'
(R):5'- TTGAAAGCTGCTGTGAATGAAG -3'

Sequencing Primer
(F):5'- GAAGTCCTGAGCTGTCACACCAG -3'
(R):5'- CAGGGTTCCTCATTAGCGAAG -3'
Posted On2015-11-11