Incidental Mutation 'R4741:Epm2aip1'
ID358092
Institutional Source Beutler Lab
Gene Symbol Epm2aip1
Ensembl Gene ENSMUSG00000046785
Gene NameEPM2A (laforin) interacting protein 1
SynonymsA930003G21Rik
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location111271929-111279093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111272613 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 218 (H218R)
Ref Sequence ENSEMBL: ENSMUSP00000120245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035079] [ENSMUST00000060711] [ENSMUST00000135218] [ENSMUST00000135807]
Predicted Effect probably benign
Transcript: ENSMUST00000035079
SMART Domains Protein: ENSMUSP00000035079
Gene: ENSMUSG00000032498

DomainStartEndE-ValueType
HATPase_c 23 158 4.57e-1 SMART
DNA_mis_repair 216 335 1.08e-44 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 429 454 N/A INTRINSIC
Pfam:Mlh1_C 504 760 8.3e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060711
AA Change: H218R

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134316
Predicted Effect probably benign
Transcript: ENSMUST00000135218
Predicted Effect probably benign
Transcript: ENSMUST00000135807
AA Change: H218R

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200053
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The EPM2A gene, which encodes laforin, is mutated in an autosomal recessive form of adolescent progressive myoclonus epilepsy. The protein encoded by this gene binds to laforin, but its function is not known. This gene is intronless. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased anxiety-related response, decreased liver glycogen storage and synthesis, hepatic steatosis, improved glucose tolerance and decreased hepatic insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Epm2aip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Epm2aip1 APN 9 111272787 missense possibly damaging 0.89
IGL01309:Epm2aip1 APN 9 111273528 missense probably benign 0.01
IGL02815:Epm2aip1 APN 9 111273560 missense probably benign
R0066:Epm2aip1 UTSW 9 111272463 missense probably benign
R0066:Epm2aip1 UTSW 9 111272463 missense probably benign
R0548:Epm2aip1 UTSW 9 111273341 missense probably damaging 1.00
R0854:Epm2aip1 UTSW 9 111272499 nonsense probably null
R1497:Epm2aip1 UTSW 9 111272247 missense possibly damaging 0.92
R4012:Epm2aip1 UTSW 9 111272390 missense probably benign 0.41
R4722:Epm2aip1 UTSW 9 111272084 small deletion probably benign
R4834:Epm2aip1 UTSW 9 111273194 missense probably benign 0.13
R5037:Epm2aip1 UTSW 9 111272150 missense probably benign 0.00
R5045:Epm2aip1 UTSW 9 111273359 missense possibly damaging 0.95
R5174:Epm2aip1 UTSW 9 111273387 missense probably damaging 1.00
R6822:Epm2aip1 UTSW 9 111272556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCATTGACAGCAACCTCC -3'
(R):5'- CTCAACAGTTCCAAGTGAAGAAATC -3'

Sequencing Primer
(F):5'- CGCAGCCAGCTGTTTAAC -3'
(R):5'- ATCCCGAATAGTGGATTACGTTCC -3'
Posted On2015-11-11