Incidental Mutation 'R4741:Tmpo'
ID358094
Institutional Source Beutler Lab
Gene Symbol Tmpo
Ensembl Gene ENSMUSG00000019961
Gene Namethymopoietin
Synonymslamina-associated polypeptide 2, TP, LAP2, 5630400D24Rik
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location91147571-91181315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91162644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 427 (V427A)
Ref Sequence ENSEMBL: ENSMUSP00000020123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020123] [ENSMUST00000072239] [ENSMUST00000092219] [ENSMUST00000099355] [ENSMUST00000105293]
PDB Structure
THE DIMERIZATION DOMAIN OF LAP2ALPHA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020123
AA Change: V427A

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020123
Gene: ENSMUSG00000019961
AA Change: V427A

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 189 197 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
Pfam:LAP2alpha 459 692 6.4e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072239
SMART Domains Protein: ENSMUSP00000072092
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 226 240 N/A INTRINSIC
transmembrane domain 410 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092219
SMART Domains Protein: ENSMUSP00000089864
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099355
SMART Domains Protein: ENSMUSP00000096956
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105293
SMART Domains Protein: ENSMUSP00000100930
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 301 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217449
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous null for a protein isoform generated from this locus have hyperproliferation of epidermal and erythroid progenitor cells that leads to thickened paws and increased crypt lengths in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Tmpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Tmpo APN 10 91164206 splice site probably benign
IGL00791:Tmpo APN 10 91162558 missense possibly damaging 0.94
IGL00919:Tmpo APN 10 91162800 missense probably damaging 0.99
IGL01382:Tmpo APN 10 91166050 missense probably damaging 1.00
IGL01806:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01813:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01838:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01952:Tmpo APN 10 91163242 missense probably benign 0.01
IGL02110:Tmpo APN 10 91162865 missense probably damaging 1.00
IGL02122:Tmpo APN 10 91164136 missense possibly damaging 0.77
IGL02191:Tmpo APN 10 91161879 missense probably benign 0.00
IGL02338:Tmpo APN 10 91163242 missense probably benign 0.01
R0133:Tmpo UTSW 10 91164038 splice site probably benign
R0450:Tmpo UTSW 10 91163096 missense probably benign 0.45
R0469:Tmpo UTSW 10 91163096 missense probably benign 0.45
R0836:Tmpo UTSW 10 91161953 nonsense probably null
R2405:Tmpo UTSW 10 91163354 missense probably damaging 1.00
R2919:Tmpo UTSW 10 91152686 missense probably benign 0.23
R4059:Tmpo UTSW 10 91162261 missense probably benign 0.00
R4296:Tmpo UTSW 10 91162956 missense possibly damaging 0.49
R4881:Tmpo UTSW 10 91162641 missense possibly damaging 0.93
R4915:Tmpo UTSW 10 91149549 missense probably damaging 1.00
R4917:Tmpo UTSW 10 91149549 missense probably damaging 1.00
R4960:Tmpo UTSW 10 91153309 missense probably damaging 1.00
R5002:Tmpo UTSW 10 91164114 missense possibly damaging 0.76
R5301:Tmpo UTSW 10 91149788 intron probably benign
R6167:Tmpo UTSW 10 91162938 missense probably benign
R6190:Tmpo UTSW 10 91164207 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCCTATCAATTTGCTGC -3'
(R):5'- GCAGGTCATTTCTCCACCAC -3'

Sequencing Primer
(F):5'- CCACCACTTTTAGGATAGATTCGTGG -3'
(R):5'- CCACCACTTGCTCAGGC -3'
Posted On2015-11-11