Incidental Mutation 'R4741:Zfp808'
ID358098
Institutional Source Beutler Lab
Gene Symbol Zfp808
Ensembl Gene ENSMUSG00000074867
Gene Namezinc finger protein 808
SynonymsGm7036
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4741 (G1)
Quality Score201
Status Not validated
Chromosome13
Chromosomal Location62129886-62236144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62171949 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 331 (C331S)
Ref Sequence ENSEMBL: ENSMUSP00000097048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099449] [ENSMUST00000221772]
Predicted Effect probably damaging
Transcript: ENSMUST00000099449
AA Change: C331S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097048
Gene: ENSMUSG00000074867
AA Change: C331S

DomainStartEndE-ValueType
KRAB 4 66 2.1e-17 SMART
ZnF_C2H2 133 155 2.4e-3 SMART
ZnF_C2H2 161 183 8.34e-3 SMART
ZnF_C2H2 189 211 2.75e-3 SMART
ZnF_C2H2 217 239 1.98e-4 SMART
ZnF_C2H2 245 267 3.21e-4 SMART
ZnF_C2H2 273 295 2.43e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 4.54e-4 SMART
ZnF_C2H2 357 379 9.22e-5 SMART
ZnF_C2H2 385 407 8.22e-2 SMART
ZnF_C2H2 413 435 1.56e-2 SMART
ZnF_C2H2 441 463 5.99e-4 SMART
ZnF_C2H2 469 491 2.79e-4 SMART
ZnF_C2H2 497 519 4.54e-4 SMART
ZnF_C2H2 525 547 1.95e-3 SMART
ZnF_C2H2 553 575 4.24e-4 SMART
ZnF_C2H2 581 603 2.27e-4 SMART
ZnF_C2H2 609 631 2.27e-4 SMART
ZnF_C2H2 637 659 9.08e-4 SMART
ZnF_C2H2 665 687 1.4e-4 SMART
ZnF_C2H2 693 715 4.24e-4 SMART
ZnF_C2H2 721 743 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221542
Predicted Effect probably benign
Transcript: ENSMUST00000221772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223094
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Other mutations in Zfp808
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Zfp808 APN 13 62173209 missense probably damaging 0.96
IGL02517:Zfp808 APN 13 62173218 makesense probably null
IGL02809:Zfp808 APN 13 62173180 missense probably benign 0.00
IGL02882:Zfp808 APN 13 62173180 missense probably benign 0.00
IGL02941:Zfp808 APN 13 62173130 missense possibly damaging 0.82
IGL03184:Zfp808 APN 13 62169567 missense possibly damaging 0.90
LCD18:Zfp808 UTSW 13 62166651 intron probably benign
R0387:Zfp808 UTSW 13 62169478 missense probably damaging 1.00
R0472:Zfp808 UTSW 13 62172306 missense probably damaging 1.00
R0544:Zfp808 UTSW 13 62169434 splice site probably benign
R0635:Zfp808 UTSW 13 62172419 missense probably damaging 1.00
R0981:Zfp808 UTSW 13 62171673 missense possibly damaging 0.47
R1446:Zfp808 UTSW 13 62173007 missense probably damaging 1.00
R1569:Zfp808 UTSW 13 62172900 nonsense probably null
R1573:Zfp808 UTSW 13 62171497 missense possibly damaging 0.52
R1761:Zfp808 UTSW 13 62171646 missense possibly damaging 0.71
R1796:Zfp808 UTSW 13 62171856 missense probably damaging 1.00
R1993:Zfp808 UTSW 13 62172907 missense probably benign 0.10
R2656:Zfp808 UTSW 13 62172852 missense possibly damaging 0.63
R2938:Zfp808 UTSW 13 62171218 missense probably benign
R3027:Zfp808 UTSW 13 62171590 missense probably benign 0.33
R3777:Zfp808 UTSW 13 62171903 missense probably damaging 0.97
R3779:Zfp808 UTSW 13 62171903 missense probably damaging 0.97
R3801:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R3802:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R3804:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R4024:Zfp808 UTSW 13 62171730 missense possibly damaging 0.71
R4791:Zfp808 UTSW 13 62171231 missense probably damaging 0.97
R4809:Zfp808 UTSW 13 62171292 nonsense probably null
R4907:Zfp808 UTSW 13 62171473 missense possibly damaging 0.71
R5056:Zfp808 UTSW 13 62172630 missense probably damaging 1.00
R5760:Zfp808 UTSW 13 62171926 missense probably damaging 1.00
R5869:Zfp808 UTSW 13 62171255 missense probably damaging 1.00
R6230:Zfp808 UTSW 13 62172322 missense probably benign 0.19
R6372:Zfp808 UTSW 13 62172477 missense probably damaging 1.00
R6545:Zfp808 UTSW 13 62171895 missense probably benign 0.02
R6620:Zfp808 UTSW 13 62172824 missense probably benign 0.08
R6622:Zfp808 UTSW 13 62171832 missense possibly damaging 0.90
R6813:Zfp808 UTSW 13 62173035 missense probably damaging 0.99
R6920:Zfp808 UTSW 13 62173168 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGAGAGAAACCCTACAAATGTGA -3'
(R):5'- GGCTTCTCTCCAGTATGTGTTC -3'

Sequencing Primer
(F):5'- ACCCTACAAATGTGATCAATGTG -3'
(R):5'- CACACTGATTACATTTGTAGGGTTTC -3'
Posted On2015-11-11