Incidental Mutation 'R4741:F2rl1'
ID358099
Institutional Source Beutler Lab
Gene Symbol F2rl1
Ensembl Gene ENSMUSG00000021678
Gene Namecoagulation factor II (thrombin) receptor-like 1
Synonymsproteinase-activated receptor-2, PAR-2, Par2, Gpcr11, Protease-activated receptor-2
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location95511732-95525227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95514143 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 77 (T77M)
Ref Sequence ENSEMBL: ENSMUSP00000022185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022185]
Predicted Effect probably damaging
Transcript: ENSMUST00000022185
AA Change: T77M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022185
Gene: ENSMUSG00000021678
AA Change: T77M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 75 363 3.8e-12 PFAM
Pfam:7TM_GPCR_Srw 82 364 1.2e-10 PFAM
Pfam:7tm_1 94 346 1.5e-42 PFAM
low complexity region 375 398 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 1 family of proteins. The encoded cell surface receptor is activated through proteolytic cleavage of its extracellular amino terminus, resulting in a new amino terminus that acts as a tethered ligand that binds to an extracellular loop domain. Activation of the receptor has been shown to stimulate vascular smooth muscle relaxation, dilate blood vessels, increase blood flow, and lower blood pressure. This protein is also important in the inflammatory response, as well as innate and adaptive immunity. [provided by RefSeq, Jun 2016]
PHENOTYPE: Nullizygous mice may exhibit impaired leukocyte rolling and dendritic cell maturation, altered inflammatory response in various models of acute and chronic inflammatory disease, altered susceptibility to injury and to autoimmune disorders, and abnormal hemodynamic responses and pain thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in F2rl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:F2rl1 APN 13 95513753 missense probably benign 0.03
IGL01996:F2rl1 APN 13 95513924 missense probably damaging 1.00
IGL02987:F2rl1 APN 13 95514233 missense probably benign 0.00
IGL03053:F2rl1 APN 13 95513618 missense probably benign 0.03
IGL03290:F2rl1 APN 13 95513589 missense possibly damaging 0.89
R2005:F2rl1 UTSW 13 95513274 missense probably damaging 1.00
R3794:F2rl1 UTSW 13 95513211 missense unknown
R4236:F2rl1 UTSW 13 95513288 missense probably damaging 1.00
R4715:F2rl1 UTSW 13 95513267 missense probably damaging 0.99
R4799:F2rl1 UTSW 13 95513969 missense possibly damaging 0.81
R4870:F2rl1 UTSW 13 95513984 missense probably damaging 0.99
R5992:F2rl1 UTSW 13 95514270 missense probably benign 0.01
R6276:F2rl1 UTSW 13 95513938 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGACCCAGTTGTTGCCATG -3'
(R):5'- AGCCTTACTGTTGGACCATTTATC -3'

Sequencing Primer
(F):5'- CCATGTAGGTGGTAGGAGATCTTCAG -3'
(R):5'- ATCTCAGTAATGATTCTGCTCCG -3'
Posted On2015-11-11