Incidental Mutation 'R4741:Lnpep'
ID358104
Institutional Source Beutler Lab
Gene Symbol Lnpep
Ensembl Gene ENSMUSG00000023845
Gene Nameleucyl/cystinyl aminopeptidase
Synonymsgp160, 4732490P18Rik, 2010309L07Rik, IRAP, vp165
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17521410-17625050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17571658 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 407 (Y407C)
Ref Sequence ENSEMBL: ENSMUSP00000036998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041047]
Predicted Effect probably damaging
Transcript: ENSMUST00000041047
AA Change: Y407C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036998
Gene: ENSMUSG00000023845
AA Change: Y407C

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Peptidase_M1 167 552 9.2e-143 PFAM
Pfam:ERAP1_C 689 1007 1e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232515
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a somewhat reduced tissue uptake of glucose either basally or after insulin stimulation. Mice homozygous for a different knock-out allele exhibit impaired coordination at 3 months and impaired spatial working memory in a Y maze at 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Lnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01983:Lnpep APN 17 17531178 missense probably damaging 1.00
IGL02008:Lnpep APN 17 17570957 missense probably benign 0.40
IGL02040:Lnpep APN 17 17544905 missense probably benign 0.13
IGL02392:Lnpep APN 17 17579183 missense possibly damaging 0.48
IGL02417:Lnpep APN 17 17544903 missense possibly damaging 0.57
IGL02659:Lnpep APN 17 17570900 missense possibly damaging 0.83
IGL02697:Lnpep APN 17 17553193 missense probably benign
IGL02947:Lnpep APN 17 17570972 missense probably damaging 1.00
IGL03493:Lnpep APN 17 17579171 missense probably damaging 1.00
I0000:Lnpep UTSW 17 17578971 missense probably damaging 1.00
R0528:Lnpep UTSW 17 17531132 splice site probably benign
R0535:Lnpep UTSW 17 17571673 missense possibly damaging 0.91
R0540:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R0586:Lnpep UTSW 17 17575396 splice site probably benign
R0607:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R1502:Lnpep UTSW 17 17571644 missense probably damaging 1.00
R1570:Lnpep UTSW 17 17579156 missense probably damaging 1.00
R1733:Lnpep UTSW 17 17553313 missense probably benign 0.00
R1826:Lnpep UTSW 17 17562836 missense probably damaging 1.00
R2015:Lnpep UTSW 17 17579063 missense probably damaging 0.99
R2029:Lnpep UTSW 17 17568399 missense probably damaging 1.00
R4593:Lnpep UTSW 17 17579027 missense probably benign 0.00
R4638:Lnpep UTSW 17 17575307 missense probably damaging 1.00
R4919:Lnpep UTSW 17 17578911 missense probably damaging 1.00
R5030:Lnpep UTSW 17 17579309 missense probably damaging 1.00
R5111:Lnpep UTSW 17 17578610 missense possibly damaging 0.93
R5203:Lnpep UTSW 17 17537063 missense probably damaging 1.00
R5320:Lnpep UTSW 17 17546465 missense possibly damaging 0.83
R5419:Lnpep UTSW 17 17566730 missense probably damaging 1.00
R5535:Lnpep UTSW 17 17538694 missense probably benign 0.02
R5680:Lnpep UTSW 17 17579182 nonsense probably null
R6134:Lnpep UTSW 17 17553192 missense probably benign
R6142:Lnpep UTSW 17 17566681 critical splice donor site probably null
R6189:Lnpep UTSW 17 17566739 missense possibly damaging 0.46
R6225:Lnpep UTSW 17 17578983 missense possibly damaging 0.66
R6350:Lnpep UTSW 17 17562809 missense probably benign 0.01
R6357:Lnpep UTSW 17 17552914 missense probably benign 0.00
R6765:Lnpep UTSW 17 17530496 missense probably damaging 1.00
R6794:Lnpep UTSW 17 17531159 missense probably damaging 1.00
X0004:Lnpep UTSW 17 17544812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCTTAAGCAAATTTCTACAACCC -3'
(R):5'- TTGCTGGTCCTAACAGTGCTC -3'

Sequencing Primer
(F):5'- CCGTACACAAATAAAATTTCTACAGC -3'
(R):5'- TCCTAACAGTGCTCAGCTGAGTG -3'
Posted On2015-11-11