Incidental Mutation 'R4741:H2-Ob'
ID358106
Institutional Source Beutler Lab
Gene Symbol H2-Ob
Ensembl Gene ENSMUSG00000041538
Gene Namehistocompatibility 2, O region beta locus
SynonymsOb, H-2Ob, H2-Ab, A-beta2, A-beta-2, H-2I, H2-IAb2, H2-Ab2
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34238903-34245907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34242571 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 95 (S95T)
Ref Sequence ENSEMBL: ENSMUSP00000133906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095342] [ENSMUST00000167280] [ENSMUST00000173764]
Predicted Effect probably benign
Transcript: ENSMUST00000095342
AA Change: S166T

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092985
Gene: ENSMUSG00000041538
AA Change: S166T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
MHC_II_beta 39 113 8.17e-34 SMART
IGc1 138 209 2.24e-24 SMART
transmembrane domain 225 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167280
AA Change: S140T

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129657
Gene: ENSMUSG00000041538
AA Change: S140T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
MHC_II_beta 39 113 8.17e-34 SMART
IGc1 120 183 4.55e-16 SMART
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173681
Predicted Effect possibly damaging
Transcript: ENSMUST00000173764
AA Change: S95T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133906
Gene: ENSMUSG00000041538
AA Change: S95T

DomainStartEndE-ValueType
Pfam:MHC_II_beta 1 42 8e-12 PFAM
IGc1 67 138 2.24e-24 SMART
transmembrane domain 154 176 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DOB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DOA) and a beta chain (DOB), both anchored in the membrane. It is located in intracellular vesicles. DO suppresses peptide loading of MHC class II molecules by inhibiting HLA-DM. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in H2-Ob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:H2-Ob APN 17 34242545 missense probably damaging 1.00
IGL03247:H2-Ob APN 17 34243492 missense probably benign
Deciduous UTSW 17 34243886 critical splice acceptor site probably null
K3955:H2-Ob UTSW 17 34241184 missense probably damaging 1.00
R0466:H2-Ob UTSW 17 34242659 missense probably damaging 0.99
R0791:H2-Ob UTSW 17 34242614 missense probably damaging 1.00
R0792:H2-Ob UTSW 17 34242614 missense probably damaging 1.00
R0812:H2-Ob UTSW 17 34244126 utr 3 prime probably benign
R2145:H2-Ob UTSW 17 34242580 missense probably benign 0.00
R4677:H2-Ob UTSW 17 34242644 missense probably benign 0.01
R5011:H2-Ob UTSW 17 34241279 critical splice donor site probably null
R5084:H2-Ob UTSW 17 34241128 missense probably damaging 1.00
R5135:H2-Ob UTSW 17 34243516 missense probably benign 0.20
R5497:H2-Ob UTSW 17 34241170 missense probably benign 0.42
R6034:H2-Ob UTSW 17 34241218 missense probably damaging 1.00
R6034:H2-Ob UTSW 17 34241218 missense probably damaging 1.00
R6272:H2-Ob UTSW 17 34242644 missense probably benign 0.01
R6433:H2-Ob UTSW 17 34243886 critical splice acceptor site probably null
R6794:H2-Ob UTSW 17 34241188 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGATGGATCACGGTGGTCAC -3'
(R):5'- TCCTACAGGTCAAGGTCCAG -3'

Sequencing Primer
(F):5'- TGGTCACAGCCCCTCTAGATG -3'
(R):5'- CTACAGGTCAAGGTCCAGAAGTAC -3'
Posted On2015-11-11