Mutagenetix > Incidental Mutations

Incidental Mutation 'R4741:Dpp9'

358107

Institutional Source

Beutler Lab

Gene Symbol

Dpp9

Ensembl Gene

ENSMUSG00000001229

Gene Name

dipeptidylpeptidase 9

Synonyms

DPRP2, 6430584G11Rik

MMRRC Submission

042026-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4741 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56186807-56218889 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56205286 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 234 (N234S)

Ref Sequence

ENSEMBL: ENSMUSP00000046604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038794]

Predicted Effect

probably benign
Transcript: ENSMUST00000038794
AA Change: N234S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000046604
Gene: ENSMUSG00000001229
AA Change: N234S

Domain	Start	End	E-Value	Type
low complexity region	122	133	N/A	INTRINSIC
Pfam:DPPIV_N	145	569	5.2e-109	PFAM
Pfam:Peptidase_S15	617	793	2.8e-10	PFAM
Pfam:Peptidase_S9	657	862	2.5e-57	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223616

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the S9B family in clan SC of the serine proteases. The protein has been shown to have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Although the activity of this protein is similar to that of dipeptidyl peptidase 4 (DPP4), it does not appear to be membrane bound. In general, dipeptidyl peptidases appear to be involved in the regulation of the activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. Several transcript variants of this gene have been described but not fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants display partial neonatal lethality and complete lethality at preweaning stages with defects suckling due to undeveveloped tongue muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,942,375	T1079A	probably damaging	Het
Angptl2	T	C	2: 33,246,188	Y462H	probably benign	Het
Arhgef12	A	G	9: 42,972,153	I1360T	possibly damaging	Het
Armc10	T	G	5: 21,651,836	L111R	probably damaging	Het
Atm	T	C	9: 53,453,607	K2628E	probably benign	Het
Best3	A	T	10: 117,023,996	N387I	probably benign	Het
Brpf3	T	C	17: 28,817,784	F721S	possibly damaging	Het
Cacna1c	A	G	6: 118,613,310	S1411P	probably damaging	Het
Cldn8	G	A	16: 88,562,408	H210Y	probably benign	Het
Clip2	T	A	5: 134,516,269	T344S	probably benign	Het
Csmd1	A	C	8: 15,910,447	W3323G	probably damaging	Het
Doc2a	A	T	7: 126,851,445	T298S	possibly damaging	Het
Dtx2	C	T	5: 136,026,517	R353C	probably benign	Het
Epm2aip1	A	G	9: 111,272,613	H218R	probably benign	Het
F2rl1	G	A	13: 95,514,143	T77M	probably damaging	Het
Fsd2	A	G	7: 81,551,895		probably null	Het
Grin2a	T	C	16: 9,663,512	Y475C	probably damaging	Het
H2-Ob	T	A	17: 34,242,571	S95T	possibly damaging	Het
Hddc3	A	G	7: 80,345,716	T160A	probably benign	Het
Hp	A	T	8: 109,575,472	C281*	probably null	Het
Ighg1	T	C	12: 113,326,558		probably benign	Het
Ints7	A	G	1: 191,619,635	I819V	probably benign	Het
Jam2	G	A	16: 84,812,952	V151M	probably damaging	Het
Jmjd1c	A	G	10: 67,224,939	I737V	possibly damaging	Het
Krt74	C	T	15: 101,761,441		noncoding transcript	Het
Lnpep	T	C	17: 17,571,658	Y407C	probably damaging	Het
Lrp4	T	G	2: 91,511,567	C1842G	probably damaging	Het
Mug2	T	A	6: 122,079,613	N1172K	probably benign	Het
Npy6r	A	T	18: 44,275,724	T71S	probably damaging	Het
Nsd3	A	T	8: 25,673,366	I591F	probably damaging	Het
Oog2	A	C	4: 144,195,145	E208D	possibly damaging	Het
Otogl	A	G	10: 107,779,260	I1928T	probably benign	Het
Papss1	T	C	3: 131,619,099	L418P	probably damaging	Het
Pcdhb13	T	A	18: 37,443,518	D316E	probably benign	Het
Pcdhgb2	T	A	18: 37,691,684		probably null	Het
Ptcd3	T	A	6: 71,902,949	L108F	probably damaging	Het
Ralgps1	T	C	2: 33,336,587	S31G	probably benign	Het
Rnf225	A	T	7: 12,927,930	H12L	probably benign	Het
Ryr3	T	A	2: 112,803,268	M2047L	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Serpinb3b	G	T	1: 107,154,470	Q355K	probably benign	Het
Slc8a2	T	A	7: 16,134,308	F155Y	probably damaging	Het
Taf1c	A	G	8: 119,603,395		probably benign	Het
Tln2	A	G	9: 67,386,555		probably null	Het
Tmpo	A	G	10: 91,162,644	V427A	probably benign	Het
Vmn1r17	A	T	6: 57,361,352	Y9*	probably null	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfand5	C	T	19: 21,276,481	T16I	probably damaging	Het
Zfp352	A	T	4: 90,224,940	K439M	possibly damaging	Het
Zfp786	G	A	6: 47,820,691	H438Y	probably damaging	Het
Zfp808	T	A	13: 62,171,949	C331S	probably damaging	Het

Other mutations in Dpp9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Dpp9	APN	17	56205240	missense	probably damaging	0.99
IGL00920:Dpp9	APN	17	56200599	missense	probably benign	0.01
IGL01568:Dpp9	APN	17	56191159	missense	probably benign
IGL01583:Dpp9	APN	17	56211666	missense	probably benign	0.00
IGL01613:Dpp9	APN	17	56190713	missense	probably benign
IGL03371:Dpp9	APN	17	56187377	missense	probably benign	0.00
R0100:Dpp9	UTSW	17	56205854	missense	possibly damaging	0.75
R0100:Dpp9	UTSW	17	56205854	missense	possibly damaging	0.75
R0418:Dpp9	UTSW	17	56194404	splice site	probably benign
R1163:Dpp9	UTSW	17	56199426	missense	possibly damaging	0.90
R1680:Dpp9	UTSW	17	56190103	missense	probably benign	0.00
R1709:Dpp9	UTSW	17	56194431	missense	probably benign
R1762:Dpp9	UTSW	17	56188362	missense	probably damaging	1.00
R1809:Dpp9	UTSW	17	56199038	missense	probably damaging	1.00
R1853:Dpp9	UTSW	17	56202885	missense	probably benign	0.00
R1854:Dpp9	UTSW	17	56202885	missense	probably benign	0.00
R2162:Dpp9	UTSW	17	56199113	missense	possibly damaging	0.81
R2205:Dpp9	UTSW	17	56199287	missense	possibly damaging	0.87
R2301:Dpp9	UTSW	17	56194973	missense	probably benign	0.00
R2520:Dpp9	UTSW	17	56206868	missense	probably damaging	1.00
R3831:Dpp9	UTSW	17	56199113	missense	possibly damaging	0.81
R3833:Dpp9	UTSW	17	56199113	missense	possibly damaging	0.81
R4364:Dpp9	UTSW	17	56187391	missense	possibly damaging	0.79
R4737:Dpp9	UTSW	17	56198970	critical splice donor site	probably null
R4740:Dpp9	UTSW	17	56198970	critical splice donor site	probably null
R4798:Dpp9	UTSW	17	56191016	missense	probably damaging	0.96
R4806:Dpp9	UTSW	17	56190030	missense	probably damaging	1.00
R5375:Dpp9	UTSW	17	56189424	nonsense	probably null
R5709:Dpp9	UTSW	17	56189393	missense	probably benign
R5783:Dpp9	UTSW	17	56211655	missense	probably damaging	0.98
R6454:Dpp9	UTSW	17	56206808	missense	probably damaging	1.00
R6532:Dpp9	UTSW	17	56205854	missense	possibly damaging	0.75
R6894:Dpp9	UTSW	17	56188321	missense	probably damaging	1.00
X0065:Dpp9	UTSW	17	56195006	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- AGAGCACATGGACTAATTCAGG -3'
(R):5'- TGATCTGTGGGTGGCAAAC -3'

Sequencing Primer
(F):5'- ACTAATTCAGGGGAGGTGTTGAGTC -3'
(R):5'- ACCTTCTGTCACCAGGGTG -3'

Posted On

2015-11-11