Incidental Mutation 'R0306:Parp14'
ID35817
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Namepoly (ADP-ribose) polymerase family, member 14
Synonymscollaborator of Stat6, 1600029O10Rik, CoaSt6
MMRRC Submission 038517-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R0306 (G1)
Quality Score201
Status Validated
Chromosome16
Chromosomal Location35832874-35871544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35856574 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1008 (L1008P)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
PDB Structure
Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000042665
AA Change: L1008P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: L1008P

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142946
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,179,889 V270A probably damaging Het
BC028528 C T 3: 95,889,820 probably benign Het
Bspry T C 4: 62,496,157 F329S probably damaging Het
Cd209a A G 8: 3,745,535 Y120H probably benign Het
Ces1f T C 8: 93,276,544 probably benign Het
Cfap52 T C 11: 67,954,070 N58D probably benign Het
Cfap74 G A 4: 155,465,439 probably benign Het
Chst8 T C 7: 34,675,298 E372G probably benign Het
Ddx49 A G 8: 70,294,672 probably benign Het
Ddx52 G T 11: 83,944,648 L133F probably benign Het
Defb26 T A 2: 152,507,968 I131F unknown Het
Dip2c T A 13: 9,604,599 S719T probably benign Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Doxl2 T C 6: 48,976,086 V315A probably damaging Het
Dytn G A 1: 63,685,113 P3S possibly damaging Het
Fmn2 T C 1: 174,609,484 probably benign Het
Gal3st1 T A 11: 3,998,546 L251Q probably damaging Het
Gm19684 A T 17: 36,127,408 probably benign Het
Il15 T A 8: 82,334,454 probably benign Het
Jag1 C T 2: 137,085,935 G852D probably damaging Het
Kbtbd4 A G 2: 90,914,186 probably benign Het
Kdm3b C A 18: 34,804,017 Q451K probably benign Het
Lrfn2 A T 17: 49,096,255 I469F probably damaging Het
Mep1a A T 17: 43,502,643 probably benign Het
Morn5 T C 2: 36,054,974 F70S probably damaging Het
Nav2 C A 7: 49,545,903 P1009Q probably benign Het
Noc3l T C 19: 38,807,650 Y334C probably damaging Het
Nsun4 A T 4: 116,052,822 Y180* probably null Het
Nup210l T C 3: 90,207,368 I1750T probably benign Het
Olfr1044 T A 2: 86,171,716 I34F possibly damaging Het
Olfr473 A T 7: 107,933,700 Y60F probably damaging Het
Olfr571 A T 7: 102,909,803 I12N probably benign Het
Paxbp1 A G 16: 91,022,115 V759A possibly damaging Het
Prdm10 C A 9: 31,316,224 Q42K probably damaging Het
Prkcsh T C 9: 22,006,526 probably benign Het
Psmg1 A G 16: 95,987,340 C138R probably damaging Het
Ptprb T C 10: 116,343,988 M1437T probably benign Het
Ryr3 A G 2: 112,775,655 probably null Het
Serpinf1 T C 11: 75,413,935 Y200C probably damaging Het
Shox2 T C 3: 66,973,834 H130R probably damaging Het
Slc22a1 A G 17: 12,662,598 F335L probably benign Het
Slc44a5 A G 3: 154,270,001 N683S probably damaging Het
Slc9a9 A T 9: 95,137,934 T519S probably benign Het
Smarca2 T A 19: 26,640,613 L348Q probably damaging Het
Sorbs1 T C 19: 40,344,411 D521G possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Srp19 T C 18: 34,334,576 probably benign Het
Stk35 T A 2: 129,801,763 Y222* probably null Het
Syt10 T G 15: 89,826,988 K114T probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Trpc4ap A G 2: 155,636,260 V662A probably benign Het
Ttll4 G A 1: 74,696,757 R1066Q probably benign Het
Tulp2 C T 7: 45,518,576 probably benign Het
Unc5b C A 10: 60,779,658 probably benign Het
Vmn1r230 T A 17: 20,846,633 I28K possibly damaging Het
Vmn2r118 A C 17: 55,608,616 F445V possibly damaging Het
Zfp142 C T 1: 74,570,182 E1485K probably damaging Het
Zfp819 C A 7: 43,617,197 A292E possibly damaging Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35841075 missense probably benign 0.00
IGL00497:Parp14 APN 16 35834836 missense probably damaging 1.00
IGL00754:Parp14 APN 16 35839371 missense probably benign 0.15
IGL00960:Parp14 APN 16 35841219 missense probably benign 0.20
IGL01321:Parp14 APN 16 35856559 missense probably benign
IGL01397:Parp14 APN 16 35858728 missense probably benign 0.19
IGL01591:Parp14 APN 16 35858507 missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35857435 missense probably damaging 1.00
IGL01734:Parp14 APN 16 35858600 missense probably benign 0.00
IGL02156:Parp14 APN 16 35858597 missense probably benign 0.13
IGL02951:Parp14 APN 16 35858533 missense probably benign 0.06
IGL03067:Parp14 APN 16 35856508 missense probably benign 0.10
IGL03135:Parp14 APN 16 35858011 missense probably damaging 1.00
IGL03141:Parp14 APN 16 35839293 missense probably benign 0.00
IGL03146:Parp14 APN 16 35858453 nonsense probably null
IGL03333:Parp14 APN 16 35841430 missense probably benign 0.08
IGL03391:Parp14 APN 16 35858270 missense probably benign
thurston UTSW 16 35844415 splice site probably benign
R0506:Parp14 UTSW 16 35841409 missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35841012 missense probably benign 0.00
R0606:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0612:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0699:Parp14 UTSW 16 35860585 missense probably damaging 1.00
R0786:Parp14 UTSW 16 35840802 missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35858518 missense probably benign 0.03
R0900:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1087:Parp14 UTSW 16 35858288 missense probably damaging 1.00
R1104:Parp14 UTSW 16 35844415 splice site probably benign
R1120:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1134:Parp14 UTSW 16 35834902 missense probably damaging 1.00
R1153:Parp14 UTSW 16 35857671 missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1160:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1237:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1238:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1239:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1423:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1511:Parp14 UTSW 16 35857224 missense probably benign 0.00
R1518:Parp14 UTSW 16 35856638 missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1707:Parp14 UTSW 16 35857849 missense probably damaging 1.00
R1792:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1831:Parp14 UTSW 16 35858588 missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35863449 missense probably damaging 1.00
R1889:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1902:Parp14 UTSW 16 35853518 critical splice donor site probably null
R1943:Parp14 UTSW 16 35836129 missense probably damaging 1.00
R1954:Parp14 UTSW 16 35858301 missense probably benign 0.08
R2115:Parp14 UTSW 16 35858534 missense probably benign 0.16
R2216:Parp14 UTSW 16 35857205 missense probably benign 0.00
R2519:Parp14 UTSW 16 35858203 missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35853748 missense possibly damaging 0.92
R4052:Parp14 UTSW 16 35858401 missense probably benign 0.05
R4671:Parp14 UTSW 16 35858321 missense probably benign 0.00
R4867:Parp14 UTSW 16 35857327 missense probably benign 0.01
R4941:Parp14 UTSW 16 35846033 missense probably benign
R4992:Parp14 UTSW 16 35841142 missense probably benign 0.05
R5055:Parp14 UTSW 16 35844363 missense probably benign 0.00
R5073:Parp14 UTSW 16 35834707 missense probably damaging 0.99
R5170:Parp14 UTSW 16 35857279 missense probably benign 0.21
R5422:Parp14 UTSW 16 35866175 missense probably benign 0.01
R5543:Parp14 UTSW 16 35834767 missense probably benign 0.00
R5549:Parp14 UTSW 16 35841135 missense probably benign 0.00
R5553:Parp14 UTSW 16 35856936 missense probably benign 0.01
R5691:Parp14 UTSW 16 35863539 missense probably benign 0.12
R5774:Parp14 UTSW 16 35858410 missense probably damaging 1.00
R5855:Parp14 UTSW 16 35840927 nonsense probably null
R5942:Parp14 UTSW 16 35839367 missense probably damaging 0.98
R5990:Parp14 UTSW 16 35841457 missense probably benign 0.14
R5991:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6018:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6022:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6075:Parp14 UTSW 16 35857019 missense probably damaging 0.99
R6395:Parp14 UTSW 16 35856548 missense probably benign 0.00
R6525:Parp14 UTSW 16 35860441 missense probably benign 0.05
R6683:Parp14 UTSW 16 35834677 missense probably damaging 1.00
X0026:Parp14 UTSW 16 35857157 nonsense probably null
X0060:Parp14 UTSW 16 35834707 missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35841586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCTCAAGAAAGCAGGTACAG -3'
(R):5'- GGAACACTTCCAGCATAAGCGAGAC -3'

Sequencing Primer
(F):5'- cacccgactgctcttcc -3'
(R):5'- CACACACACCTTGAAAAAGATTTAC -3'
Posted On2013-05-09