Incidental Mutation 'R4743:Tbc1d7'
ID358189
Institutional Source Beutler Lab
Gene Symbol Tbc1d7
Ensembl Gene ENSMUSG00000021368
Gene NameTBC1 domain family, member 7
Synonyms
MMRRC Submission 041967-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R4743 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location43151740-43171501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43169849 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 22 (V22A)
Ref Sequence ENSEMBL: ENSMUSP00000152208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021797] [ENSMUST00000179852] [ENSMUST00000220787] [ENSMUST00000221352] [ENSMUST00000221795] [ENSMUST00000222160] [ENSMUST00000223000]
Predicted Effect probably damaging
Transcript: ENSMUST00000021797
AA Change: V22A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021797
Gene: ENSMUSG00000021368
AA Change: V22A

DomainStartEndE-ValueType
SCOP:d1fkma1 24 90 5e-3 SMART
Pfam:RabGAP-TBC 133 251 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179852
AA Change: V22A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137280
Gene: ENSMUSG00000021368
AA Change: V22A

DomainStartEndE-ValueType
SCOP:d1fkma1 24 90 5e-3 SMART
Pfam:RabGAP-TBC 133 251 5.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220787
AA Change: V22A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221095
Predicted Effect probably damaging
Transcript: ENSMUST00000221352
AA Change: V22A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000221795
AA Change: V22A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000222160
AA Change: V22A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223000
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4933407L21Rik A G 1: 85,931,251 probably benign Het
Ahcy T C 2: 155,068,968 N27D probably damaging Het
Akap9 T G 5: 3,961,013 L572R probably damaging Het
Akna A G 4: 63,378,613 S909P probably damaging Het
Atr A G 9: 95,862,792 E54G probably benign Het
Baz2b A G 2: 59,913,911 S1417P probably benign Het
Colgalt2 A G 1: 152,400,343 Y69C probably damaging Het
Comp A G 8: 70,376,061 E181G probably damaging Het
Dcaf10 T A 4: 45,370,409 S326T probably damaging Het
Dscam T C 16: 96,830,056 E253G probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Epha1 G T 6: 42,372,221 T36K probably benign Het
Ewsr1 A T 11: 5,083,541 D210E unknown Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fndc1 T A 17: 7,772,279 R862* probably null Het
Gbp8 T C 5: 105,030,841 K203E possibly damaging Het
Gigyf2 T A 1: 87,365,248 L79* probably null Het
Gm8220 T A 14: 44,285,695 probably benign Het
Gm9755 A T 8: 67,514,277 noncoding transcript Het
Il6 T C 5: 30,018,044 Y120H probably damaging Het
Kcnma1 T C 14: 23,803,202 T2A probably damaging Het
Mroh9 T C 1: 163,024,492 Y876C probably benign Het
Plekhh2 A G 17: 84,571,120 Y601C probably damaging Het
Rabgap1l G T 1: 160,453,783 Q623K probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rapgef2 T C 3: 79,173,068 Y109C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Slain2 T A 5: 72,957,584 L386* probably null Het
Slc4a7 A G 14: 14,796,073 probably null Het
Slco1c1 T C 6: 141,564,516 C582R probably damaging Het
Sulf1 A G 1: 12,836,293 N520D probably benign Het
Tmprss6 A G 15: 78,443,710 V612A probably damaging Het
Trpv2 A G 11: 62,592,801 E488G probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uspl1 A G 5: 149,209,756 Y439C probably damaging Het
Vwf A G 6: 125,684,091 probably null Het
Other mutations in Tbc1d7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Tbc1d7 APN 13 43159321 missense probably damaging 1.00
IGL01460:Tbc1d7 APN 13 43165359 missense probably benign 0.00
IGL02653:Tbc1d7 APN 13 43165398 missense probably benign
IGL03046:Tbc1d7 APN 13 43154686 splice site probably null
R0165:Tbc1d7 UTSW 13 43153202 splice site probably null
R0427:Tbc1d7 UTSW 13 43153087 missense probably benign 0.01
R0863:Tbc1d7 UTSW 13 43154685 splice site probably benign
R0930:Tbc1d7 UTSW 13 43165336 nonsense probably null
R1181:Tbc1d7 UTSW 13 43153139 missense probably damaging 1.00
R1792:Tbc1d7 UTSW 13 43165377 missense probably benign
R2113:Tbc1d7 UTSW 13 43153086 missense probably damaging 0.99
R4354:Tbc1d7 UTSW 13 43169868 missense probably damaging 1.00
R5407:Tbc1d7 UTSW 13 43154702 missense probably benign 0.01
R6049:Tbc1d7 UTSW 13 43159360 missense probably damaging 0.99
R6320:Tbc1d7 UTSW 13 43152933 unclassified probably benign
R7024:Tbc1d7 UTSW 13 43154735 missense probably damaging 1.00
R7241:Tbc1d7 UTSW 13 43153017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATAACAACCTTCTGCCTCTCAATG -3'
(R):5'- GCTTAGGGCCAGGCAATTTATC -3'

Sequencing Primer
(F):5'- CTGCCTCTCAATGAATCTGAAAAATC -3'
(R):5'- GGGCCAGGCAATTTATCATATTTGAC -3'
Posted On2015-11-11