Incidental Mutation 'R4757:Col4a4'
ID358201
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Namecollagen, type IV, alpha 4
SynonymsE130010M05Rik, [a]4(IV)
MMRRC Submission 041973-MU
Accession Numbers

Genbank: NM_007735; MGI: 104687

Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location82448423-82586849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82528466 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 298 (F298L)
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
Predicted Effect unknown
Transcript: ENSMUST00000087050
AA Change: F298L
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: F298L

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82491641 missense unknown
IGL01092:Col4a4 APN 1 82466545 missense unknown
IGL01104:Col4a4 APN 1 82466545 missense unknown
IGL01413:Col4a4 APN 1 82471248 missense unknown
IGL01518:Col4a4 APN 1 82455759 missense unknown
IGL02014:Col4a4 APN 1 82523960 splice site probably benign
IGL02215:Col4a4 APN 1 82453809 missense unknown
IGL02707:Col4a4 APN 1 82493516 missense unknown
IGL02858:Col4a4 APN 1 82528483 missense unknown
IGL02987:Col4a4 APN 1 82498925 splice site probably benign
IGL03384:Col4a4 APN 1 82484438 missense probably benign 0.04
aoba UTSW 1 82535740 critical splice donor site probably benign
IGL02980:Col4a4 UTSW 1 82469477 critical splice donor site probably null
R0028:Col4a4 UTSW 1 82487510 critical splice donor site probably null
R0083:Col4a4 UTSW 1 82507111 critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82492549 missense unknown
R0788:Col4a4 UTSW 1 82524996 missense unknown
R0789:Col4a4 UTSW 1 82524996 missense unknown
R0790:Col4a4 UTSW 1 82524996 missense unknown
R0894:Col4a4 UTSW 1 82529656 splice site probably null
R1217:Col4a4 UTSW 1 82489009 critical splice donor site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1474:Col4a4 UTSW 1 82480486 nonsense probably null
R1508:Col4a4 UTSW 1 82455836 missense unknown
R1640:Col4a4 UTSW 1 82535770 missense unknown
R1678:Col4a4 UTSW 1 82486659 missense unknown
R1827:Col4a4 UTSW 1 82539988 missense unknown
R1930:Col4a4 UTSW 1 82466600 splice site probably null
R1931:Col4a4 UTSW 1 82466600 splice site probably null
R2092:Col4a4 UTSW 1 82498946 missense unknown
R2122:Col4a4 UTSW 1 82456871 missense unknown
R2132:Col4a4 UTSW 1 82497860 missense unknown
R2396:Col4a4 UTSW 1 82507072 missense unknown
R2418:Col4a4 UTSW 1 82532936 missense unknown
R2679:Col4a4 UTSW 1 82529611 missense unknown
R3085:Col4a4 UTSW 1 82529564 critical splice donor site probably null
R3437:Col4a4 UTSW 1 82497168 missense unknown
R3697:Col4a4 UTSW 1 82541237 missense unknown
R3730:Col4a4 UTSW 1 82455751 synonymous probably null
R3752:Col4a4 UTSW 1 82480494 missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82471188 critical splice donor site probably null
R4087:Col4a4 UTSW 1 82523922 missense unknown
R4088:Col4a4 UTSW 1 82523922 missense unknown
R4090:Col4a4 UTSW 1 82523922 missense unknown
R4213:Col4a4 UTSW 1 82453144 missense unknown
R4422:Col4a4 UTSW 1 82489838 missense unknown
R4596:Col4a4 UTSW 1 82471219 missense unknown
R4755:Col4a4 UTSW 1 82541174 missense unknown
R4793:Col4a4 UTSW 1 82539099 missense unknown
R4812:Col4a4 UTSW 1 82462153 missense unknown
R4833:Col4a4 UTSW 1 82529602 missense unknown
R5259:Col4a4 UTSW 1 82453893 missense unknown
R5264:Col4a4 UTSW 1 82493591 missense unknown
R5265:Col4a4 UTSW 1 82493591 missense unknown
R5281:Col4a4 UTSW 1 82493591 missense unknown
R5283:Col4a4 UTSW 1 82493591 missense unknown
R5284:Col4a4 UTSW 1 82493591 missense unknown
R5387:Col4a4 UTSW 1 82493591 missense unknown
R5388:Col4a4 UTSW 1 82493591 missense unknown
R5435:Col4a4 UTSW 1 82454007 missense unknown
R5534:Col4a4 UTSW 1 82487517 missense unknown
R5666:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5670:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5943:Col4a4 UTSW 1 82525016 missense unknown
R5996:Col4a4 UTSW 1 82455728 missense unknown
R5999:Col4a4 UTSW 1 82492619 missense unknown
R6112:Col4a4 UTSW 1 82453883 missense unknown
R6192:Col4a4 UTSW 1 82484430 missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82507031 missense unknown
R6419:Col4a4 UTSW 1 82466486 critical splice donor site probably null
R6458:Col4a4 UTSW 1 82455825 missense unknown
R6460:Col4a4 UTSW 1 82466532 missense unknown
R6481:Col4a4 UTSW 1 82453778 missense unknown
R6522:Col4a4 UTSW 1 82487583 missense unknown
X0020:Col4a4 UTSW 1 82539952 critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82453196 missense unknown
Predicted Primers PCR Primer
(F):5'- GGAACAGCCACAATCCTGTC -3'
(R):5'- TCCATTCTAAGGAAGTTGCTCTC -3'

Sequencing Primer
(F):5'- CTCTATGCCTGCTGTATTTAAAGGAC -3'
(R):5'- GAAGTTGCTCTCTTTAAACTGTTGC -3'
Posted On2015-11-11