Incidental Mutation 'R4757:Nedd4l'
ID358274
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R4757 (G1)
Quality Score193
Status Not validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65165605 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 343 (S343G)
Ref Sequence ENSEMBL: ENSMUSP00000132838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000225261] [ENSMUST00000226058]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080418
AA Change: S222G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: S222G

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: S343G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: S343G

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000224347
AA Change: S222G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224890
Predicted Effect probably benign
Transcript: ENSMUST00000225261
Predicted Effect possibly damaging
Transcript: ENSMUST00000226058
AA Change: S222G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAACTGAGCTCTGGAAGGG -3'
(R):5'- CAGCAGCCCTGAAGATTTTAAATC -3'

Sequencing Primer
(F):5'- TCTGGAAGGGCTACGGTCAC -3'
(R):5'- CAGCCCTGAAGATTTTAAATCAAAGC -3'
Posted On2015-11-11