Incidental Mutation 'R4725:Smpdl3b'
ID358389
Institutional Source Beutler Lab
Gene Symbol Smpdl3b
Ensembl Gene ENSMUSG00000028885
Gene Namesphingomyelin phosphodiesterase, acid-like 3B
Synonyms1110054A24Rik, Asml3b
MMRRC Submission 041960-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4725 (G1)
Quality Score171
Status Validated
Chromosome4
Chromosomal Location132732966-132757252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132745178 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 95 (T95A)
Ref Sequence ENSEMBL: ENSMUSP00000030709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030709]
Predicted Effect probably damaging
Transcript: ENSMUST00000030709
AA Change: T95A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030709
Gene: ENSMUSG00000028885
AA Change: T95A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Metallophos 21 281 1.9e-20 PFAM
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal but exhibit an enhanced inflammatory response in models of Toll-like receptor (TLR)-dependent peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,703 probably benign Het
Adamts20 T C 15: 94,351,762 E458G probably damaging Het
Adgrl3 T C 5: 81,766,205 I1220T possibly damaging Het
Aldh1a1 T A 19: 20,640,081 M459K probably benign Het
Arntl C A 7: 113,304,359 P454Q possibly damaging Het
Camta1 A G 4: 151,148,496 V240A probably benign Het
Ccdc88b C T 19: 6,857,113 G149R probably damaging Het
Ceacam5 T C 7: 17,760,677 V870A probably benign Het
Cep192 A C 18: 67,816,766 Q307P probably benign Het
Cep63 T C 9: 102,590,556 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Ctdsp1 G A 1: 74,394,664 V135I possibly damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dchs1 C G 7: 105,765,552 G761A probably damaging Het
Dennd5b A G 6: 149,044,779 Y445H probably damaging Het
Dock1 T A 7: 134,745,014 L225* probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Dysf A T 6: 84,097,756 N527I probably damaging Het
Erbb2 A G 11: 98,425,144 T358A possibly damaging Het
Fhad1 A T 4: 141,928,378 probably null Het
Ganc T C 2: 120,435,273 I434T probably damaging Het
Gm15448 A C 7: 3,821,548 S611A probably benign Het
Gm5830 T A 1: 78,967,832 noncoding transcript Het
Gm6096 G T 7: 34,251,059 E8* probably null Het
Gne A G 4: 44,066,806 F63S probably benign Het
Gpat2 T C 2: 127,431,982 V315A possibly damaging Het
Gpr33 A G 12: 52,024,109 L49P probably damaging Het
Heatr1 C T 13: 12,424,662 Q1374* probably null Het
Hivep1 A G 13: 42,163,411 I2032V probably benign Het
Igkv2-112 A C 6: 68,220,466 I40L probably benign Het
Kcnab3 A G 11: 69,330,468 N204D probably benign Het
Kcnj10 T A 1: 172,369,159 F80Y probably damaging Het
Lcmt2 C G 2: 121,139,430 V171L probably benign Het
Loxhd1 T A 18: 77,395,457 Y1245N probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Mast1 A G 8: 84,929,006 S170P possibly damaging Het
Mroh4 A G 15: 74,616,107 L322P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nudcd3 A T 11: 6,193,475 V1D probably damaging Het
Pah T A 10: 87,554,376 L25Q probably damaging Het
Pik3cg A T 12: 32,193,597 probably null Het
Plekha6 C A 1: 133,283,320 S625Y probably damaging Het
Rtn4 T A 11: 29,708,362 S839T probably damaging Het
Rusc1 A G 3: 89,091,429 S349P possibly damaging Het
Samsn1 A T 16: 75,945,329 noncoding transcript Het
Scimp A G 11: 70,800,713 V30A probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sgip1 A G 4: 102,966,222 D680G probably damaging Het
Slc44a2 G A 9: 21,348,395 V613M probably damaging Het
Spag6l A T 16: 16,792,531 L85H probably damaging Het
Sucla2 T A 14: 73,568,989 Y167N possibly damaging Het
Svop G T 5: 114,065,485 probably benign Het
Tnxb A T 17: 34,699,067 D2318V probably damaging Het
Trbv14 A G 6: 41,135,398 D43G probably benign Het
Ubn2 A G 6: 38,522,305 probably benign Het
Ufsp1 T C 5: 137,295,307 I173T probably damaging Het
Zbtb40 A G 4: 137,018,761 probably benign Het
Other mutations in Smpdl3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Smpdl3b APN 4 132733713 missense probably benign 0.11
IGL03166:Smpdl3b APN 4 132741531 missense probably benign 0.00
R0321:Smpdl3b UTSW 4 132741444 missense probably damaging 0.99
R0450:Smpdl3b UTSW 4 132745138 missense probably damaging 1.00
R0510:Smpdl3b UTSW 4 132745138 missense probably damaging 1.00
R1462:Smpdl3b UTSW 4 132746614 missense probably damaging 1.00
R1462:Smpdl3b UTSW 4 132746614 missense probably damaging 1.00
R4844:Smpdl3b UTSW 4 132738058 missense probably damaging 1.00
R6290:Smpdl3b UTSW 4 132738275 missense possibly damaging 0.67
R6992:Smpdl3b UTSW 4 132745141 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAAGGTCCATATTCCAGCTCTC -3'
(R):5'- CCCAGAGAGCTGTGTAGAAATC -3'

Sequencing Primer
(F):5'- AAGGTCCATATTCCAGCTCTCCTATC -3'
(R):5'- TTGCAGCTCAGATAGGCTAC -3'
Posted On2015-11-11