Incidental Mutation 'R4727:Cacna1e'
ID 358512
Institutional Source Beutler Lab
Gene Symbol Cacna1e
Ensembl Gene ENSMUSG00000004110
Gene Name calcium channel, voltage-dependent, R type, alpha 1E subunit
Synonyms Cav2.3, Cchra1, alpha1E
MMRRC Submission 041602-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R4727 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 154266477-154760247 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 154312214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1530 (Q1530*)
Ref Sequence ENSEMBL: ENSMUSP00000148507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000004214
AA Change: Q1284*
SMART Domains Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: Q1284*

DomainStartEndE-ValueType
Pfam:Ion_trans 1 55 6.7e-10 PFAM
Pfam:Ion_trans 168 407 3.3e-56 PFAM
Pfam:PKD_channel 257 401 3.3e-7 PFAM
low complexity region 409 414 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
coiled coil region 793 823 N/A INTRINSIC
Pfam:Ion_trans 847 1128 2.3e-63 PFAM
Pfam:Ion_trans 1172 1429 2.6e-65 PFAM
Pfam:PKD_channel 1256 1424 2.8e-10 PFAM
Pfam:GPHH 1431 1500 1.3e-37 PFAM
Ca_chan_IQ 1555 1589 5.93e-13 SMART
low complexity region 1701 1717 N/A INTRINSIC
low complexity region 1729 1742 N/A INTRINSIC
low complexity region 1764 1780 N/A INTRINSIC
low complexity region 1789 1804 N/A INTRINSIC
low complexity region 1808 1822 N/A INTRINSIC
low complexity region 1832 1846 N/A INTRINSIC
low complexity region 1867 1878 N/A INTRINSIC
low complexity region 1936 1946 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187541
AA Change: Q1592*
SMART Domains Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: Q1592*

DomainStartEndE-ValueType
Pfam:Ion_trans 128 351 8.5e-54 PFAM
PDB:4DEX|B 354 462 6e-36 PDB
Pfam:Ion_trans 511 703 2.2e-46 PFAM
Pfam:PKD_channel 565 710 1.4e-6 PFAM
low complexity region 717 722 N/A INTRINSIC
low complexity region 763 777 N/A INTRINSIC
low complexity region 804 822 N/A INTRINSIC
low complexity region 912 928 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
coiled coil region 1101 1131 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
Pfam:Ion_trans 1191 1425 4.3e-55 PFAM
Pfam:Ion_trans 1515 1725 5.3e-60 PFAM
Pfam:PKD_channel 1565 1732 4.7e-10 PFAM
Ca_chan_IQ 1863 1897 5.93e-13 SMART
low complexity region 2009 2025 N/A INTRINSIC
low complexity region 2037 2050 N/A INTRINSIC
low complexity region 2072 2088 N/A INTRINSIC
low complexity region 2097 2112 N/A INTRINSIC
low complexity region 2116 2130 N/A INTRINSIC
low complexity region 2140 2154 N/A INTRINSIC
low complexity region 2175 2186 N/A INTRINSIC
low complexity region 2244 2254 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000211821
AA Change: Q1530*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,062,489 (GRCm39) N483S probably benign Het
Acoxl T G 2: 127,820,658 (GRCm39) L70R probably damaging Het
Ankrd44 A T 1: 54,706,576 (GRCm39) F627I probably benign Het
Ash2l A T 8: 26,308,623 (GRCm39) I552N probably damaging Het
B4galt1 A G 4: 40,807,812 (GRCm39) S330P probably damaging Het
Bnip3 T C 7: 138,500,435 (GRCm39) S52G probably damaging Het
Btd A G 14: 31,384,278 (GRCm39) Q88R probably benign Het
C4bp A G 1: 130,566,922 (GRCm39) V318A probably benign Het
Calm1 T C 12: 100,166,485 (GRCm39) F23S probably benign Het
Cep290 T G 10: 100,399,132 (GRCm39) I2218R probably benign Het
Ces2c T C 8: 105,574,672 (GRCm39) I43T probably benign Het
Cyp2d9 T C 15: 82,338,602 (GRCm39) L1P probably null Het
Dgki C A 6: 37,276,748 (GRCm39) probably benign Het
Dhh A G 15: 98,796,023 (GRCm39) L44P probably damaging Het
Dnah12 A G 14: 26,594,274 (GRCm39) I3409V probably damaging Het
Dnah7b G A 1: 46,246,816 (GRCm39) R1664H probably damaging Het
Dnah8 T C 17: 31,070,721 (GRCm39) M4469T probably damaging Het
Ehhadh T C 16: 21,581,181 (GRCm39) I604V probably benign Het
Esr1 A G 10: 4,951,418 (GRCm39) I599V probably benign Het
Faf1 G A 4: 109,697,564 (GRCm39) D297N probably damaging Het
Gfra1 A T 19: 58,252,386 (GRCm39) N380K probably damaging Het
Ghitm A G 14: 36,855,700 (GRCm39) C8R probably damaging Het
Ifna4 C A 4: 88,760,519 (GRCm39) T141K probably benign Het
Itsn2 A G 12: 4,757,660 (GRCm39) Y1424C probably damaging Het
Kcnj10 A G 1: 172,197,266 (GRCm39) D260G probably damaging Het
Klf16 T C 10: 80,405,020 (GRCm39) D164G probably damaging Het
Klhdc7b T A 15: 89,271,785 (GRCm39) L889Q probably damaging Het
Lcmt2 C G 2: 120,969,911 (GRCm39) V171L probably benign Het
Lrp11 A G 10: 7,466,348 (GRCm39) E153G probably benign Het
Lrrc43 A T 5: 123,632,366 (GRCm39) T170S probably damaging Het
Lsr T C 7: 30,665,465 (GRCm39) Y163C probably damaging Het
Man1a A T 10: 53,783,668 (GRCm39) probably null Het
Mmp24 C T 2: 155,657,819 (GRCm39) P570S possibly damaging Het
Ms4a3 A G 19: 11,608,742 (GRCm39) M170T probably damaging Het
Naip5 C A 13: 100,358,378 (GRCm39) A953S possibly damaging Het
Nfrkb T C 9: 31,314,919 (GRCm39) S580P probably damaging Het
Or51q1c T G 7: 103,653,097 (GRCm39) V205G probably benign Het
Or8b38 T C 9: 37,973,389 (GRCm39) Y258H probably damaging Het
Padi6 T G 4: 140,458,506 (GRCm39) D462A probably damaging Het
Pde6a A G 18: 61,364,561 (GRCm39) R206G probably benign Het
Plk4 A G 3: 40,759,589 (GRCm39) N162D probably benign Het
Ptpn13 T A 5: 103,717,721 (GRCm39) D1922E probably benign Het
Rangap1 G A 15: 81,613,956 (GRCm39) probably benign Het
Rapgef3 A G 15: 97,658,481 (GRCm39) L175P probably damaging Het
Rps6kb1 G C 11: 86,435,484 (GRCm39) probably null Het
Satb1 T C 17: 52,111,375 (GRCm39) Y161C probably damaging Het
Sel1l3 C A 5: 53,301,525 (GRCm39) probably null Het
Slc17a7 C T 7: 44,822,358 (GRCm39) S398L possibly damaging Het
Slc22a4 T A 11: 53,918,477 (GRCm39) E109V possibly damaging Het
Slc26a7 C T 4: 14,590,477 (GRCm39) A105T probably damaging Het
Slc47a1 T C 11: 61,254,277 (GRCm39) N145S possibly damaging Het
Tank A G 2: 61,483,876 (GRCm39) T441A probably benign Het
Tefm T C 11: 80,031,279 (GRCm39) probably benign Het
Ttbk2 T C 2: 120,575,851 (GRCm39) Y1042C probably benign Het
Wdfy3 T C 5: 102,077,894 (GRCm39) Q892R probably damaging Het
Wdr33 T A 18: 32,021,500 (GRCm39) H683Q unknown Het
Zfp36l2 T A 17: 84,495,089 (GRCm39) I12F probably benign Het
Zfyve26 A T 12: 79,291,170 (GRCm39) M2145K probably benign Het
Other mutations in Cacna1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Cacna1e APN 1 154,279,429 (GRCm39) missense probably damaging 0.99
IGL01086:Cacna1e APN 1 154,347,347 (GRCm39) missense probably benign 0.04
IGL01302:Cacna1e APN 1 154,319,653 (GRCm39) missense probably damaging 1.00
IGL01386:Cacna1e APN 1 154,348,123 (GRCm39) missense probably benign 0.18
IGL01573:Cacna1e APN 1 154,347,113 (GRCm39) missense probably benign
IGL01676:Cacna1e APN 1 154,288,196 (GRCm39) missense probably damaging 1.00
IGL01676:Cacna1e APN 1 154,274,222 (GRCm39) missense probably damaging 1.00
IGL01762:Cacna1e APN 1 154,347,119 (GRCm39) missense possibly damaging 0.78
IGL01801:Cacna1e APN 1 154,347,086 (GRCm39) missense probably null 0.00
IGL01895:Cacna1e APN 1 154,319,646 (GRCm39) missense probably damaging 1.00
IGL02391:Cacna1e APN 1 154,296,859 (GRCm39) missense probably damaging 1.00
IGL02399:Cacna1e APN 1 154,279,493 (GRCm39) missense probably damaging 1.00
IGL02659:Cacna1e APN 1 154,302,274 (GRCm39) missense probably damaging 1.00
IGL02686:Cacna1e APN 1 154,369,155 (GRCm39) missense probably damaging 1.00
IGL02838:Cacna1e APN 1 154,321,394 (GRCm39) missense probably damaging 1.00
IGL02958:Cacna1e APN 1 154,341,487 (GRCm39) missense probably damaging 1.00
IGL02981:Cacna1e APN 1 154,347,171 (GRCm39) missense probably benign 0.15
IGL03120:Cacna1e APN 1 154,319,627 (GRCm39) missense probably damaging 1.00
IGL03232:Cacna1e APN 1 154,369,104 (GRCm39) missense probably damaging 1.00
IGL03310:Cacna1e APN 1 154,317,997 (GRCm39) missense probably damaging 1.00
IGL03342:Cacna1e APN 1 154,342,690 (GRCm39) critical splice donor site probably null
bezoar UTSW 1 154,312,300 (GRCm39) splice site probably null
hairball UTSW 1 154,355,051 (GRCm39) missense probably damaging 0.97
N/A - 535:Cacna1e UTSW 1 154,341,510 (GRCm39) missense probably damaging 1.00
R0122:Cacna1e UTSW 1 154,319,647 (GRCm39) missense probably damaging 1.00
R0143:Cacna1e UTSW 1 154,324,693 (GRCm39) splice site probably null
R0314:Cacna1e UTSW 1 154,317,997 (GRCm39) missense probably damaging 1.00
R0366:Cacna1e UTSW 1 154,291,884 (GRCm39) missense probably benign 0.03
R0626:Cacna1e UTSW 1 154,364,563 (GRCm39) missense probably damaging 0.99
R0739:Cacna1e UTSW 1 154,318,024 (GRCm39) missense probably damaging 0.97
R1272:Cacna1e UTSW 1 154,320,714 (GRCm39) missense probably damaging 1.00
R1300:Cacna1e UTSW 1 154,274,419 (GRCm39) missense probably benign
R1340:Cacna1e UTSW 1 154,348,403 (GRCm39) missense probably damaging 1.00
R1440:Cacna1e UTSW 1 154,437,552 (GRCm39) missense possibly damaging 0.63
R1449:Cacna1e UTSW 1 154,361,408 (GRCm39) critical splice donor site probably null
R1538:Cacna1e UTSW 1 154,437,504 (GRCm39) missense probably damaging 0.99
R1542:Cacna1e UTSW 1 154,353,525 (GRCm39) missense probably benign 0.01
R1560:Cacna1e UTSW 1 154,296,850 (GRCm39) nonsense probably null
R1748:Cacna1e UTSW 1 154,362,315 (GRCm39) missense possibly damaging 0.92
R1749:Cacna1e UTSW 1 154,319,746 (GRCm39) missense probably damaging 1.00
R1912:Cacna1e UTSW 1 154,312,195 (GRCm39) missense probably damaging 1.00
R1968:Cacna1e UTSW 1 154,576,240 (GRCm39) missense probably damaging 1.00
R1993:Cacna1e UTSW 1 154,353,563 (GRCm39) missense probably damaging 0.97
R1994:Cacna1e UTSW 1 154,353,563 (GRCm39) missense probably damaging 0.97
R2191:Cacna1e UTSW 1 154,319,591 (GRCm39) missense probably damaging 1.00
R2291:Cacna1e UTSW 1 154,279,429 (GRCm39) missense probably damaging 0.99
R2417:Cacna1e UTSW 1 154,347,939 (GRCm39) missense probably damaging 1.00
R3608:Cacna1e UTSW 1 154,291,831 (GRCm39) missense probably benign 0.08
R3757:Cacna1e UTSW 1 154,509,442 (GRCm39) missense probably damaging 0.97
R3890:Cacna1e UTSW 1 154,359,299 (GRCm39) missense probably damaging 1.00
R4015:Cacna1e UTSW 1 154,358,331 (GRCm39) missense probably damaging 1.00
R4088:Cacna1e UTSW 1 154,287,929 (GRCm39) splice site probably null
R4275:Cacna1e UTSW 1 154,369,071 (GRCm39) missense probably damaging 1.00
R4282:Cacna1e UTSW 1 154,302,296 (GRCm39) missense probably benign 0.04
R4297:Cacna1e UTSW 1 154,274,477 (GRCm39) missense probably benign 0.37
R4356:Cacna1e UTSW 1 154,319,727 (GRCm39) missense probably damaging 1.00
R4510:Cacna1e UTSW 1 154,437,579 (GRCm39) missense probably damaging 1.00
R4511:Cacna1e UTSW 1 154,437,579 (GRCm39) missense probably damaging 1.00
R4577:Cacna1e UTSW 1 154,277,773 (GRCm39) missense possibly damaging 0.92
R4590:Cacna1e UTSW 1 154,312,265 (GRCm39) missense possibly damaging 0.87
R4601:Cacna1e UTSW 1 154,347,359 (GRCm39) missense probably benign
R4622:Cacna1e UTSW 1 154,347,311 (GRCm39) missense possibly damaging 0.81
R4626:Cacna1e UTSW 1 154,358,294 (GRCm39) splice site probably null
R4694:Cacna1e UTSW 1 154,313,012 (GRCm39) critical splice donor site probably null
R4839:Cacna1e UTSW 1 154,296,804 (GRCm39) missense probably damaging 1.00
R4851:Cacna1e UTSW 1 154,312,300 (GRCm39) splice site probably null
R4894:Cacna1e UTSW 1 154,364,551 (GRCm39) nonsense probably null
R4934:Cacna1e UTSW 1 154,357,380 (GRCm39) nonsense probably null
R4979:Cacna1e UTSW 1 154,289,739 (GRCm39) missense probably damaging 1.00
R5077:Cacna1e UTSW 1 154,437,475 (GRCm39) critical splice donor site probably null
R5128:Cacna1e UTSW 1 154,277,767 (GRCm39) missense probably damaging 0.98
R5214:Cacna1e UTSW 1 154,577,110 (GRCm39) missense possibly damaging 0.93
R5274:Cacna1e UTSW 1 154,576,250 (GRCm39) missense probably damaging 0.98
R5388:Cacna1e UTSW 1 154,353,542 (GRCm39) missense probably damaging 1.00
R5416:Cacna1e UTSW 1 154,341,525 (GRCm39) missense probably damaging 1.00
R5469:Cacna1e UTSW 1 154,319,683 (GRCm39) missense probably damaging 1.00
R5475:Cacna1e UTSW 1 154,601,455 (GRCm39) missense possibly damaging 0.53
R5607:Cacna1e UTSW 1 154,347,086 (GRCm39) missense probably benign 0.00
R5615:Cacna1e UTSW 1 154,287,916 (GRCm39) missense probably damaging 1.00
R5616:Cacna1e UTSW 1 154,317,940 (GRCm39) missense probably damaging 1.00
R5627:Cacna1e UTSW 1 154,511,604 (GRCm39) missense probably damaging 0.98
R5707:Cacna1e UTSW 1 154,509,463 (GRCm39) missense probably damaging 1.00
R5756:Cacna1e UTSW 1 154,347,383 (GRCm39) missense probably benign 0.00
R5893:Cacna1e UTSW 1 154,313,069 (GRCm39) missense probably damaging 1.00
R6117:Cacna1e UTSW 1 154,437,537 (GRCm39) missense possibly damaging 0.68
R6134:Cacna1e UTSW 1 154,577,037 (GRCm39) missense probably damaging 1.00
R6190:Cacna1e UTSW 1 154,362,316 (GRCm39) missense possibly damaging 0.47
R6279:Cacna1e UTSW 1 154,301,678 (GRCm39) missense probably benign 0.38
R6295:Cacna1e UTSW 1 154,317,919 (GRCm39) missense probably damaging 0.98
R6300:Cacna1e UTSW 1 154,301,678 (GRCm39) missense probably benign 0.38
R6320:Cacna1e UTSW 1 154,317,270 (GRCm39) missense possibly damaging 0.76
R6375:Cacna1e UTSW 1 154,355,051 (GRCm39) missense probably damaging 0.97
R6830:Cacna1e UTSW 1 154,289,720 (GRCm39) critical splice donor site probably null
R6842:Cacna1e UTSW 1 154,358,863 (GRCm39) missense probably damaging 1.00
R7023:Cacna1e UTSW 1 154,601,439 (GRCm39) missense probably null 0.85
R7081:Cacna1e UTSW 1 154,576,129 (GRCm39) missense possibly damaging 0.82
R7085:Cacna1e UTSW 1 154,349,492 (GRCm39) splice site probably null
R7108:Cacna1e UTSW 1 154,344,741 (GRCm39) frame shift probably null
R7142:Cacna1e UTSW 1 154,288,230 (GRCm39) missense probably damaging 1.00
R7250:Cacna1e UTSW 1 154,576,235 (GRCm39) missense possibly damaging 0.93
R7332:Cacna1e UTSW 1 154,601,547 (GRCm39) missense possibly damaging 0.89
R7410:Cacna1e UTSW 1 154,347,980 (GRCm39) missense probably benign 0.13
R7502:Cacna1e UTSW 1 154,344,734 (GRCm39) missense probably null 0.35
R7556:Cacna1e UTSW 1 154,348,419 (GRCm39) missense probably benign 0.28
R7563:Cacna1e UTSW 1 154,347,162 (GRCm39) missense probably benign 0.00
R7573:Cacna1e UTSW 1 154,601,911 (GRCm39) intron probably benign
R7689:Cacna1e UTSW 1 154,274,549 (GRCm39) missense probably benign 0.01
R7699:Cacna1e UTSW 1 154,319,674 (GRCm39) missense probably damaging 1.00
R7744:Cacna1e UTSW 1 154,341,538 (GRCm39) missense probably damaging 1.00
R7754:Cacna1e UTSW 1 154,288,863 (GRCm39) missense probably damaging 0.97
R7787:Cacna1e UTSW 1 154,358,314 (GRCm39) missense probably damaging 0.98
R7818:Cacna1e UTSW 1 154,274,152 (GRCm39) missense probably damaging 1.00
R7838:Cacna1e UTSW 1 154,347,149 (GRCm39) missense probably benign 0.08
R7849:Cacna1e UTSW 1 154,509,464 (GRCm39) missense probably damaging 1.00
R8011:Cacna1e UTSW 1 154,341,568 (GRCm39) missense probably benign 0.01
R8094:Cacna1e UTSW 1 154,437,516 (GRCm39) missense probably damaging 1.00
R8162:Cacna1e UTSW 1 154,577,313 (GRCm39) splice site probably null
R8202:Cacna1e UTSW 1 154,274,195 (GRCm39) missense probably benign
R8280:Cacna1e UTSW 1 154,344,839 (GRCm39) missense probably damaging 0.97
R8354:Cacna1e UTSW 1 154,274,314 (GRCm39) missense probably damaging 1.00
R8385:Cacna1e UTSW 1 154,319,687 (GRCm39) missense probably damaging 0.98
R8532:Cacna1e UTSW 1 154,341,510 (GRCm39) missense probably damaging 1.00
R8902:Cacna1e UTSW 1 154,349,632 (GRCm39) missense probably benign 0.01
R8926:Cacna1e UTSW 1 154,577,080 (GRCm39) missense possibly damaging 0.84
R8947:Cacna1e UTSW 1 154,277,896 (GRCm39) missense probably benign 0.10
R9094:Cacna1e UTSW 1 154,355,064 (GRCm39) missense possibly damaging 0.93
R9126:Cacna1e UTSW 1 154,343,510 (GRCm39) missense probably benign 0.01
R9175:Cacna1e UTSW 1 154,274,314 (GRCm39) missense probably damaging 1.00
R9286:Cacna1e UTSW 1 154,288,845 (GRCm39) missense probably damaging 1.00
R9377:Cacna1e UTSW 1 154,361,458 (GRCm39) missense possibly damaging 0.88
R9452:Cacna1e UTSW 1 154,289,720 (GRCm39) critical splice donor site probably null
R9463:Cacna1e UTSW 1 154,357,411 (GRCm39) missense probably damaging 1.00
R9513:Cacna1e UTSW 1 154,318,033 (GRCm39) missense probably damaging 1.00
R9534:Cacna1e UTSW 1 154,320,693 (GRCm39) missense possibly damaging 0.65
R9562:Cacna1e UTSW 1 154,283,486 (GRCm39) missense probably benign 0.01
RF008:Cacna1e UTSW 1 154,317,882 (GRCm39) missense probably damaging 1.00
X0062:Cacna1e UTSW 1 154,288,238 (GRCm39) missense probably damaging 1.00
Z1176:Cacna1e UTSW 1 154,511,596 (GRCm39) missense probably damaging 0.98
Z1177:Cacna1e UTSW 1 154,318,038 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGCCTGCGCTATAATC -3'
(R):5'- TGCAAAAGACAGAGACTGCC -3'

Sequencing Primer
(F):5'- GCCTGCGCTATAATCAAGAACTATTG -3'
(R):5'- GACAGAGACTGCCATCTATTTTGTG -3'
Posted On 2015-11-11