Incidental Mutation 'R4729:Zfp719'
ID358679
Institutional Source Beutler Lab
Gene Symbol Zfp719
Ensembl Gene ENSMUSG00000030469
Gene Namezinc finger protein 719
Synonyms9430094P17Rik, mszf6, C630016O21Rik
MMRRC Submission 041603-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4729 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43579610-43593235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43590410 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 474 (I474N)
Ref Sequence ENSEMBL: ENSMUSP00000050968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058104] [ENSMUST00000205769]
Predicted Effect probably damaging
Transcript: ENSMUST00000058104
AA Change: I474N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050968
Gene: ENSMUSG00000030469
AA Change: I474N

DomainStartEndE-ValueType
KRAB 49 109 1.18e-20 SMART
ZnF_C2H2 285 305 4.16e1 SMART
ZnF_C2H2 341 363 1.2e-3 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
ZnF_C2H2 397 419 6.67e-2 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 3.34e-2 SMART
ZnF_C2H2 481 503 1.38e-3 SMART
ZnF_C2H2 509 531 5.42e-2 SMART
ZnF_C2H2 537 559 3.78e-1 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 4.54e-4 SMART
ZnF_C2H2 621 643 4.24e-4 SMART
ZnF_C2H2 649 671 6.42e-4 SMART
ZnF_C2H2 677 699 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205769
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,849,323 L220H unknown Het
Amt T A 9: 108,300,652 L272Q probably damaging Het
Ank2 G C 3: 126,976,896 Y894* probably null Het
Ankzf1 T A 1: 75,194,264 F105I probably damaging Het
Aox4 C A 1: 58,259,077 Y1067* probably null Het
BC034090 T A 1: 155,225,090 Q476L probably damaging Het
Bhmt G T 13: 93,627,363 R57S probably damaging Het
Cacna1c A T 6: 118,656,175 F964L probably damaging Het
Celsr3 A C 9: 108,847,652 S396R probably benign Het
Cpne4 C A 9: 104,922,556 Q191K probably damaging Het
Csnk1g2 T C 10: 80,639,204 Y352H probably benign Het
D630003M21Rik A G 2: 158,216,703 S426P probably damaging Het
Dido1 G T 2: 180,687,650 N326K probably benign Het
E2f2 T A 4: 136,184,449 I257N probably damaging Het
Elfn1 T G 5: 139,973,658 F806V probably damaging Het
Eml6 T A 11: 29,833,204 Y559F probably damaging Het
Erich6 A G 3: 58,636,059 probably null Het
Fam45a T A 19: 60,834,871 F315I probably benign Het
Fam78a T C 2: 32,082,605 N101S probably damaging Het
Fam83h A G 15: 76,002,336 S1051P probably benign Het
Galns C T 8: 122,603,456 G112D probably damaging Het
Gm7075 A T 10: 63,421,465 V92E probably damaging Het
Gm9923 A G 10: 72,309,694 K125R probably damaging Het
Hectd3 G A 4: 116,997,218 V326M probably damaging Het
Iars2 A G 1: 185,316,051 S495P possibly damaging Het
Ice1 T C 13: 70,606,384 R528G probably damaging Het
Igkv12-38 T A 6: 69,943,384 Y50F possibly damaging Het
Inpp5j T C 11: 3,495,025 S883G probably damaging Het
Irf8 T C 8: 120,753,439 S139P probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kcnq4 G T 4: 120,713,074 D357E possibly damaging Het
Klhl1 A G 14: 96,280,148 L364P probably damaging Het
Krt7 A G 15: 101,420,558 I309V probably benign Het
Krt76 G T 15: 101,889,081 A281D probably damaging Het
Lancl2 T C 6: 57,737,712 F430L probably damaging Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc26 A T 2: 25,290,064 T26S probably benign Het
Lrrk1 T A 7: 66,262,293 M1840L probably benign Het
Lyst G A 13: 13,637,901 C966Y probably damaging Het
Mad1l1 T A 5: 140,261,511 S354C possibly damaging Het
Mbtps1 C T 8: 119,525,420 G577D probably damaging Het
Mycbp2 C T 14: 103,188,591 R2366H probably damaging Het
Myo18a T G 11: 77,777,685 probably null Het
Naip5 G A 13: 100,222,131 R866C possibly damaging Het
Nav2 T A 7: 49,452,819 V455E probably benign Het
Neb A G 2: 52,263,662 I2417T possibly damaging Het
Nme5 C T 18: 34,569,837 A133T probably benign Het
Nradd T C 9: 110,621,911 D51G possibly damaging Het
Pard3b A G 1: 62,211,684 R591G probably damaging Het
Pcbp4 T C 9: 106,460,730 F73S probably damaging Het
Pcdhb11 C T 18: 37,422,366 Q250* probably null Het
Pde1c T A 6: 56,072,209 K766N probably damaging Het
Phf21b G A 15: 84,854,741 Q40* probably null Het
Prr14 A G 7: 127,474,696 D244G probably benign Het
Rab11fip5 C T 6: 85,374,267 A88T probably damaging Het
Rad54l2 A T 9: 106,716,118 S428T probably benign Het
Rdh9 A G 10: 127,776,752 I90V probably benign Het
Rhag G T 17: 40,828,401 G76C probably damaging Het
Riok3 T A 18: 12,128,927 V6E possibly damaging Het
Scn10a A G 9: 119,671,526 I229T probably damaging Het
Slco1a1 G T 6: 141,908,969 T652K probably benign Het
Slit1 T A 19: 41,647,020 I345F probably damaging Het
Snrnp200 A T 2: 127,232,937 I1477F probably damaging Het
Snx31 G A 15: 36,523,552 T328I possibly damaging Het
Strn A G 17: 78,657,961 F634S probably damaging Het
Tmem101 C T 11: 102,156,329 G6R probably benign Het
Tmem199 C G 11: 78,508,680 G131R probably benign Het
Trim66 A G 7: 109,456,060 probably null Het
Ttn G T 2: 76,851,585 probably benign Het
Upk3bl T C 5: 136,057,393 L61P probably benign Het
Vmn2r108 A G 17: 20,472,370 Y75H probably damaging Het
Vmn2r91 T A 17: 18,107,644 I500K probably damaging Het
Vps18 C T 2: 119,293,791 R400C probably damaging Het
Zeb1 C T 18: 5,767,286 P599L probably damaging Het
Zfhx4 G T 3: 5,399,497 A1572S probably damaging Het
Zfp677 T A 17: 21,397,418 C246S possibly damaging Het
Other mutations in Zfp719
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Zfp719 APN 7 43591130 missense probably damaging 1.00
IGL01407:Zfp719 APN 7 43584187 missense probably benign 0.00
IGL01763:Zfp719 APN 7 43584189 missense probably benign 0.00
IGL03079:Zfp719 APN 7 43591166 missense probably damaging 1.00
R0522:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0524:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0542:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0543:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0662:Zfp719 UTSW 7 43584254 missense possibly damaging 0.56
R1390:Zfp719 UTSW 7 43590443 missense possibly damaging 0.69
R2959:Zfp719 UTSW 7 43590427 missense possibly damaging 0.89
R4708:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4709:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4710:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4716:Zfp719 UTSW 7 43591111 missense possibly damaging 0.80
R4755:Zfp719 UTSW 7 43590793 missense probably damaging 1.00
R5176:Zfp719 UTSW 7 43591125 missense probably damaging 1.00
R5949:Zfp719 UTSW 7 43584117 intron probably benign
R6063:Zfp719 UTSW 7 43589626 nonsense probably null
R6363:Zfp719 UTSW 7 43589866 missense probably benign 0.03
R6434:Zfp719 UTSW 7 43590988 missense probably damaging 1.00
R6465:Zfp719 UTSW 7 43590684 nonsense probably null
R6806:Zfp719 UTSW 7 43586385 missense possibly damaging 0.63
R6925:Zfp719 UTSW 7 43590706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTGACTGTGGGAAAATG -3'
(R):5'- ACAGTCAGAACATTTGTAAGGCT -3'

Sequencing Primer
(F):5'- AAACATTGTCGATTTCACACAGGGG -3'
(R):5'- CCCACAGTCATGGCATTTGTAAGG -3'
Posted On2015-11-11