Incidental Mutation 'R4730:Duox1'
ID358736
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Namedual oxidase 1
SynonymsTHOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission 041990-MU
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4730 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122315672-122347972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 122333831 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 924 (L924R)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
Predicted Effect probably damaging
Transcript: ENSMUST00000099461
AA Change: L924R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: L924R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 A G 5: 103,843,073 Q963R possibly damaging Het
Arhgef28 C T 13: 97,978,142 E645K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Col4a2 A G 8: 11,437,590 N964S probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Edem2 T C 2: 155,705,698 E398G possibly damaging Het
Engase A G 11: 118,482,922 N297D probably damaging Het
Esp4 A C 17: 40,602,554 Y104S unknown Het
Esp4 C A 17: 40,602,555 Y104* probably null Het
Fat1 A T 8: 45,033,477 N3356I probably damaging Het
Gm3867 T A 9: 36,257,254 noncoding transcript Het
Gm6818 C T 7: 38,402,494 noncoding transcript Het
Grip2 T C 6: 91,785,712 *175W probably null Het
Gucy1b2 A G 14: 62,407,759 V617A probably damaging Het
Gzmc C T 14: 56,231,632 C210Y probably damaging Het
Hmg20a T A 9: 56,467,419 S20T possibly damaging Het
Hs3st1 A T 5: 39,614,805 L165* probably null Het
Ighv1-26 A G 12: 114,788,789 I6T probably benign Het
Kcnk13 A G 12: 100,061,715 K350E probably damaging Het
Lin9 T A 1: 180,665,851 L198* probably null Het
Lrfn5 C T 12: 61,840,719 A431V probably benign Het
Lta C T 17: 35,204,089 R86Q probably benign Het
Map3k4 T A 17: 12,248,974 I1058L probably damaging Het
Mtif2 T A 11: 29,540,834 S513T probably benign Het
Muc4 C T 16: 32,751,214 T364I possibly damaging Het
Nav1 C A 1: 135,607,311 probably benign Het
Nfrkb T C 9: 31,410,251 V748A probably benign Het
Obox6 A T 7: 15,834,813 M46K possibly damaging Het
Olfr1002 T C 2: 85,647,992 T110A probably benign Het
Olfr1013 G T 2: 85,770,061 E87* probably null Het
Olfr1102 C T 2: 87,002,166 R66W possibly damaging Het
Olfr172 T C 16: 58,760,742 I145V probably benign Het
Olfr820 G A 10: 130,017,547 R62Q probably damaging Het
P4htm A G 9: 108,579,772 V412A possibly damaging Het
Phb2 T C 6: 124,713,123 S92P probably damaging Het
Phtf1 G T 3: 103,987,435 R147L probably damaging Het
Pigk C T 3: 152,742,566 Q189* probably null Het
Plxnc1 G A 10: 94,867,468 probably benign Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Ptprg G A 14: 12,213,713 G252D probably damaging Het
Rnf4 G T 5: 34,350,803 V134F possibly damaging Het
Scarf2 A G 16: 17,803,013 T182A probably damaging Het
Setd1a A G 7: 127,797,330 probably benign Het
Sgpp1 A G 12: 75,734,939 F209L probably benign Het
Sh3d19 T A 3: 86,116,864 S567T possibly damaging Het
Slc4a2 C T 5: 24,434,880 R520W probably damaging Het
Slf1 T C 13: 77,046,632 Q858R probably damaging Het
Slitrk3 G T 3: 73,049,519 A640E probably benign Het
Smarca2 A G 19: 26,630,673 Y44C probably damaging Het
Spon1 A G 7: 114,033,071 E543G possibly damaging Het
Strn4 A G 7: 16,828,794 Q286R possibly damaging Het
Suz12 T C 11: 80,002,162 probably benign Het
Syna T A 5: 134,558,586 E503V probably damaging Het
Syt14 C T 1: 192,930,786 D569N probably damaging Het
Sytl2 A G 7: 90,381,249 probably benign Het
Tmprss11g G T 5: 86,489,232 S335* probably null Het
Tmprss11g A T 5: 86,489,233 S335T probably damaging Het
Trim66 A G 7: 109,483,069 S226P probably damaging Het
Tubgcp3 T C 8: 12,657,654 T112A probably benign Het
Ulk4 T C 9: 121,263,725 S149G probably benign Het
Usp53 T C 3: 122,962,933 D108G probably null Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 intron probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGGAGGATCCTGACGTGG -3'
(R):5'- CTGCTGCAAGCTTAGAGATGC -3'

Sequencing Primer
(F):5'- GATGGCCAGTGCTTGCTTCC -3'
(R):5'- GTAGCGCACATCAGTTATCTTCAG -3'
Posted On2015-11-11