Incidental Mutation 'R4730:Strn4'
ID358754
Institutional Source Beutler Lab
Gene Symbol Strn4
Ensembl Gene ENSMUSG00000030374
Gene Namestriatin, calmodulin binding protein 4
SynonymsZIN, zinedin
MMRRC Submission 041990-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R4730 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16815889-16840931 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16828794 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 286 (Q286R)
Ref Sequence ENSEMBL: ENSMUSP00000104135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019220] [ENSMUST00000108495] [ENSMUST00000185011]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019220
AA Change: Q286R

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019220
Gene: ENSMUSG00000030374
AA Change: Q286R

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 193 1.2e-44 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
WD40 434 473 5.72e-9 SMART
WD40 487 526 6.53e-4 SMART
WD40 540 579 6.99e-13 SMART
WD40 584 626 2.38e1 SMART
WD40 629 672 3.55e1 SMART
WD40 675 714 5.34e-9 SMART
WD40 717 760 1.58e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108495
AA Change: Q286R

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104135
Gene: ENSMUSG00000030374
AA Change: Q286R

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 197 1.4e-45 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 409 422 N/A INTRINSIC
WD40 427 466 5.72e-9 SMART
WD40 480 519 6.53e-4 SMART
WD40 533 572 6.99e-13 SMART
WD40 577 619 2.38e1 SMART
WD40 622 665 3.55e1 SMART
WD40 668 707 5.34e-9 SMART
WD40 710 753 1.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138070
Predicted Effect probably benign
Transcript: ENSMUST00000184280
Predicted Effect unknown
Transcript: ENSMUST00000184708
AA Change: Q135R
Predicted Effect probably benign
Transcript: ENSMUST00000185011
SMART Domains Protein: ENSMUSP00000139290
Gene: ENSMUSG00000030374

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 A G 5: 103,843,073 Q963R possibly damaging Het
Arhgef28 C T 13: 97,978,142 E645K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Col4a2 A G 8: 11,437,590 N964S probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Duox1 T G 2: 122,333,831 L924R probably damaging Het
Edem2 T C 2: 155,705,698 E398G possibly damaging Het
Engase A G 11: 118,482,922 N297D probably damaging Het
Esp4 A C 17: 40,602,554 Y104S unknown Het
Esp4 C A 17: 40,602,555 Y104* probably null Het
Fat1 A T 8: 45,033,477 N3356I probably damaging Het
Gm3867 T A 9: 36,257,254 noncoding transcript Het
Gm6818 C T 7: 38,402,494 noncoding transcript Het
Grip2 T C 6: 91,785,712 *175W probably null Het
Gucy1b2 A G 14: 62,407,759 V617A probably damaging Het
Gzmc C T 14: 56,231,632 C210Y probably damaging Het
Hmg20a T A 9: 56,467,419 S20T possibly damaging Het
Hs3st1 A T 5: 39,614,805 L165* probably null Het
Ighv1-26 A G 12: 114,788,789 I6T probably benign Het
Kcnk13 A G 12: 100,061,715 K350E probably damaging Het
Lin9 T A 1: 180,665,851 L198* probably null Het
Lrfn5 C T 12: 61,840,719 A431V probably benign Het
Lta C T 17: 35,204,089 R86Q probably benign Het
Map3k4 T A 17: 12,248,974 I1058L probably damaging Het
Mtif2 T A 11: 29,540,834 S513T probably benign Het
Muc4 C T 16: 32,751,214 T364I possibly damaging Het
Nav1 C A 1: 135,607,311 probably benign Het
Nfrkb T C 9: 31,410,251 V748A probably benign Het
Obox6 A T 7: 15,834,813 M46K possibly damaging Het
Olfr1002 T C 2: 85,647,992 T110A probably benign Het
Olfr1013 G T 2: 85,770,061 E87* probably null Het
Olfr1102 C T 2: 87,002,166 R66W possibly damaging Het
Olfr172 T C 16: 58,760,742 I145V probably benign Het
Olfr820 G A 10: 130,017,547 R62Q probably damaging Het
P4htm A G 9: 108,579,772 V412A possibly damaging Het
Phb2 T C 6: 124,713,123 S92P probably damaging Het
Phtf1 G T 3: 103,987,435 R147L probably damaging Het
Pigk C T 3: 152,742,566 Q189* probably null Het
Plxnc1 G A 10: 94,867,468 probably benign Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Ptprg G A 14: 12,213,713 G252D probably damaging Het
Rnf4 G T 5: 34,350,803 V134F possibly damaging Het
Scarf2 A G 16: 17,803,013 T182A probably damaging Het
Setd1a A G 7: 127,797,330 probably benign Het
Sgpp1 A G 12: 75,734,939 F209L probably benign Het
Sh3d19 T A 3: 86,116,864 S567T possibly damaging Het
Slc4a2 C T 5: 24,434,880 R520W probably damaging Het
Slf1 T C 13: 77,046,632 Q858R probably damaging Het
Slitrk3 G T 3: 73,049,519 A640E probably benign Het
Smarca2 A G 19: 26,630,673 Y44C probably damaging Het
Spon1 A G 7: 114,033,071 E543G possibly damaging Het
Suz12 T C 11: 80,002,162 probably benign Het
Syna T A 5: 134,558,586 E503V probably damaging Het
Syt14 C T 1: 192,930,786 D569N probably damaging Het
Sytl2 A G 7: 90,381,249 probably benign Het
Tmprss11g G T 5: 86,489,232 S335* probably null Het
Tmprss11g A T 5: 86,489,233 S335T probably damaging Het
Trim66 A G 7: 109,483,069 S226P probably damaging Het
Tubgcp3 T C 8: 12,657,654 T112A probably benign Het
Ulk4 T C 9: 121,263,725 S149G probably benign Het
Usp53 T C 3: 122,962,933 D108G probably null Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Other mutations in Strn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Strn4 APN 7 16830452 missense probably damaging 1.00
IGL01153:Strn4 APN 7 16837921 missense probably damaging 1.00
IGL01748:Strn4 APN 7 16838302 missense probably damaging 1.00
IGL03227:Strn4 APN 7 16837714 missense possibly damaging 0.79
PIT4260001:Strn4 UTSW 7 16822509 missense probably damaging 1.00
R0948:Strn4 UTSW 7 16837713 nonsense probably null
R1876:Strn4 UTSW 7 16838282 missense probably damaging 1.00
R1918:Strn4 UTSW 7 16833921 missense probably damaging 1.00
R2015:Strn4 UTSW 7 16833028 missense possibly damaging 0.85
R2250:Strn4 UTSW 7 16826466 missense probably damaging 1.00
R3435:Strn4 UTSW 7 16837633 missense possibly damaging 0.86
R3686:Strn4 UTSW 7 16822581 missense probably damaging 1.00
R3688:Strn4 UTSW 7 16822581 missense probably damaging 1.00
R3887:Strn4 UTSW 7 16822998 unclassified probably benign
R4613:Strn4 UTSW 7 16824163 missense possibly damaging 0.50
R5590:Strn4 UTSW 7 16833874 critical splice acceptor site probably null
R5924:Strn4 UTSW 7 16838321 missense probably damaging 1.00
R6327:Strn4 UTSW 7 16816459 missense probably benign 0.00
R6759:Strn4 UTSW 7 16823053 missense probably damaging 1.00
R6866:Strn4 UTSW 7 16828785 missense probably damaging 0.97
R6976:Strn4 UTSW 7 16830354 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCTGGGTTCTGTCACCTGAAG -3'
(R):5'- CCCTTTTCAGGATATGGGAACAG -3'

Sequencing Primer
(F):5'- CTGTCACCTGAAGACTGAGTGTC -3'
(R):5'- ACAGAAAGCAAGAGTCACTGG -3'
Posted On2015-11-11