Incidental Mutation 'R4730:Engase'
ID358778
Institutional Source Beutler Lab
Gene Symbol Engase
Ensembl Gene ENSMUSG00000033857
Gene Nameendo-beta-N-acetylglucosaminidase
Synonyms
MMRRC Submission 041990-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4730 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118476829-118489209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118482922 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 297 (N297D)
Ref Sequence ENSEMBL: ENSMUSP00000117538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043447] [ENSMUST00000135383] [ENSMUST00000139917] [ENSMUST00000166995] [ENSMUST00000168689] [ENSMUST00000171769] [ENSMUST00000172279]
Predicted Effect probably benign
Transcript: ENSMUST00000043447
Predicted Effect probably damaging
Transcript: ENSMUST00000135383
AA Change: N297D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117538
Gene: ENSMUSG00000033857
AA Change: N297D

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Glyco_hydro_85 127 404 2.6e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139813
Predicted Effect probably benign
Transcript: ENSMUST00000139917
SMART Domains Protein: ENSMUSP00000129698
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153825
Predicted Effect probably benign
Transcript: ENSMUST00000166995
SMART Domains Protein: ENSMUSP00000127862
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168689
SMART Domains Protein: ENSMUSP00000125886
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
PDB:3FHA|D 13 143 1e-5 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168785
Predicted Effect probably benign
Transcript: ENSMUST00000171769
SMART Domains Protein: ENSMUSP00000132734
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172279
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme which catalyzes the hydrolysis of peptides and proteins with mannose modifications to produce free oligosaccharides. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozgyous for knock-out alleles of this gene and Ngly1 exhibit restored endoplasmic reticulum (ER)-associated degradation (ERAD) process compared with MEFs lacking only Ngly1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 A G 5: 103,843,073 Q963R possibly damaging Het
Arhgef28 C T 13: 97,978,142 E645K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Col4a2 A G 8: 11,437,590 N964S probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Duox1 T G 2: 122,333,831 L924R probably damaging Het
Edem2 T C 2: 155,705,698 E398G possibly damaging Het
Esp4 A C 17: 40,602,554 Y104S unknown Het
Esp4 C A 17: 40,602,555 Y104* probably null Het
Fat1 A T 8: 45,033,477 N3356I probably damaging Het
Gm3867 T A 9: 36,257,254 noncoding transcript Het
Gm6818 C T 7: 38,402,494 noncoding transcript Het
Grip2 T C 6: 91,785,712 *175W probably null Het
Gucy1b2 A G 14: 62,407,759 V617A probably damaging Het
Gzmc C T 14: 56,231,632 C210Y probably damaging Het
Hmg20a T A 9: 56,467,419 S20T possibly damaging Het
Hs3st1 A T 5: 39,614,805 L165* probably null Het
Ighv1-26 A G 12: 114,788,789 I6T probably benign Het
Kcnk13 A G 12: 100,061,715 K350E probably damaging Het
Lin9 T A 1: 180,665,851 L198* probably null Het
Lrfn5 C T 12: 61,840,719 A431V probably benign Het
Lta C T 17: 35,204,089 R86Q probably benign Het
Map3k4 T A 17: 12,248,974 I1058L probably damaging Het
Mtif2 T A 11: 29,540,834 S513T probably benign Het
Muc4 C T 16: 32,751,214 T364I possibly damaging Het
Nav1 C A 1: 135,607,311 probably benign Het
Nfrkb T C 9: 31,410,251 V748A probably benign Het
Obox6 A T 7: 15,834,813 M46K possibly damaging Het
Olfr1002 T C 2: 85,647,992 T110A probably benign Het
Olfr1013 G T 2: 85,770,061 E87* probably null Het
Olfr1102 C T 2: 87,002,166 R66W possibly damaging Het
Olfr172 T C 16: 58,760,742 I145V probably benign Het
Olfr820 G A 10: 130,017,547 R62Q probably damaging Het
P4htm A G 9: 108,579,772 V412A possibly damaging Het
Phb2 T C 6: 124,713,123 S92P probably damaging Het
Phtf1 G T 3: 103,987,435 R147L probably damaging Het
Pigk C T 3: 152,742,566 Q189* probably null Het
Plxnc1 G A 10: 94,867,468 probably benign Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Ptprg G A 14: 12,213,713 G252D probably damaging Het
Rnf4 G T 5: 34,350,803 V134F possibly damaging Het
Scarf2 A G 16: 17,803,013 T182A probably damaging Het
Setd1a A G 7: 127,797,330 probably benign Het
Sgpp1 A G 12: 75,734,939 F209L probably benign Het
Sh3d19 T A 3: 86,116,864 S567T possibly damaging Het
Slc4a2 C T 5: 24,434,880 R520W probably damaging Het
Slf1 T C 13: 77,046,632 Q858R probably damaging Het
Slitrk3 G T 3: 73,049,519 A640E probably benign Het
Smarca2 A G 19: 26,630,673 Y44C probably damaging Het
Spon1 A G 7: 114,033,071 E543G possibly damaging Het
Strn4 A G 7: 16,828,794 Q286R possibly damaging Het
Suz12 T C 11: 80,002,162 probably benign Het
Syna T A 5: 134,558,586 E503V probably damaging Het
Syt14 C T 1: 192,930,786 D569N probably damaging Het
Sytl2 A G 7: 90,381,249 probably benign Het
Tmprss11g G T 5: 86,489,232 S335* probably null Het
Tmprss11g A T 5: 86,489,233 S335T probably damaging Het
Trim66 A G 7: 109,483,069 S226P probably damaging Het
Tubgcp3 T C 8: 12,657,654 T112A probably benign Het
Ulk4 T C 9: 121,263,725 S149G probably benign Het
Usp53 T C 3: 122,962,933 D108G probably null Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Other mutations in Engase
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Engase APN 11 118482970 missense possibly damaging 0.91
IGL00963:Engase APN 11 118482998 missense probably damaging 1.00
IGL02652:Engase APN 11 118478950 missense probably damaging 0.99
R0135:Engase UTSW 11 118484478 missense possibly damaging 0.68
R1337:Engase UTSW 11 118482574 missense possibly damaging 0.46
R1435:Engase UTSW 11 118484901 missense probably damaging 1.00
R1515:Engase UTSW 11 118487140 missense possibly damaging 0.53
R1889:Engase UTSW 11 118478933 missense probably damaging 1.00
R1939:Engase UTSW 11 118479186 missense probably damaging 1.00
R4628:Engase UTSW 11 118484905 missense probably damaging 1.00
R4762:Engase UTSW 11 118487094 missense possibly damaging 0.89
R4775:Engase UTSW 11 118482671 missense probably benign 0.22
R5155:Engase UTSW 11 118481281 missense probably benign 0.25
R5271:Engase UTSW 11 118481397 missense probably damaging 0.99
R5688:Engase UTSW 11 118487320 missense possibly damaging 0.91
R6659:Engase UTSW 11 118481316 missense probably benign 0.07
R7104:Engase UTSW 11 118481295 missense probably damaging 0.98
R7233:Engase UTSW 11 118483001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGCAGGAAGATGAGCTG -3'
(R):5'- CTAGTGAGAATGGAAGAACCCC -3'

Sequencing Primer
(F):5'- AGATGAGCTGGCCAGGC -3'
(R):5'- GGTCACAGAGGGCATGC -3'
Posted On2015-11-11