Incidental Mutation 'R4730:Smarca2'
ID358796
Institutional Source Beutler Lab
Gene Symbol Smarca2
Ensembl Gene ENSMUSG00000024921
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
SynonymsSnf2l2, brm, 2610209L14Rik
MMRRC Submission 041990-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4730 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location26605050-26778322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26630673 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 44 (Y44C)
Ref Sequence ENSEMBL: ENSMUSP00000146859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176584] [ENSMUST00000176769] [ENSMUST00000208163]
Predicted Effect probably damaging
Transcript: ENSMUST00000025862
AA Change: Y120C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: Y120C

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1501 3.13e-41 SMART
low complexity region 1502 1524 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1564 1576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099537
AA Change: Y120C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: Y120C

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 7e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
PDB:2DAT|A 1389 1410 1e-6 PDB
low complexity region 1480 1508 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176030
AA Change: Y120C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: Y120C

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1519 1.74e-39 SMART
low complexity region 1520 1542 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176584
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135344
Gene: ENSMUSG00000024921
AA Change: Y44C

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
QLQ 96 132 2.58e-13 SMART
low complexity region 140 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176769
AA Change: Y120C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921
AA Change: Y120C

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 908 4.18e-24 SMART
low complexity region 947 956 N/A INTRINSIC
HELICc 1033 1117 3.84e-23 SMART
low complexity region 1175 1190 N/A INTRINSIC
SnAC 1211 1279 7.29e-28 SMART
low complexity region 1286 1308 N/A INTRINSIC
BROMO 1333 1443 3.13e-41 SMART
low complexity region 1444 1466 N/A INTRINSIC
low complexity region 1468 1482 N/A INTRINSIC
low complexity region 1506 1518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208163
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 A G 5: 103,843,073 Q963R possibly damaging Het
Arhgef28 C T 13: 97,978,142 E645K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Col4a2 A G 8: 11,437,590 N964S probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Duox1 T G 2: 122,333,831 L924R probably damaging Het
Edem2 T C 2: 155,705,698 E398G possibly damaging Het
Engase A G 11: 118,482,922 N297D probably damaging Het
Esp4 A C 17: 40,602,554 Y104S unknown Het
Esp4 C A 17: 40,602,555 Y104* probably null Het
Fat1 A T 8: 45,033,477 N3356I probably damaging Het
Gm3867 T A 9: 36,257,254 noncoding transcript Het
Gm6818 C T 7: 38,402,494 noncoding transcript Het
Grip2 T C 6: 91,785,712 *175W probably null Het
Gucy1b2 A G 14: 62,407,759 V617A probably damaging Het
Gzmc C T 14: 56,231,632 C210Y probably damaging Het
Hmg20a T A 9: 56,467,419 S20T possibly damaging Het
Hs3st1 A T 5: 39,614,805 L165* probably null Het
Ighv1-26 A G 12: 114,788,789 I6T probably benign Het
Kcnk13 A G 12: 100,061,715 K350E probably damaging Het
Lin9 T A 1: 180,665,851 L198* probably null Het
Lrfn5 C T 12: 61,840,719 A431V probably benign Het
Lta C T 17: 35,204,089 R86Q probably benign Het
Map3k4 T A 17: 12,248,974 I1058L probably damaging Het
Mtif2 T A 11: 29,540,834 S513T probably benign Het
Muc4 C T 16: 32,751,214 T364I possibly damaging Het
Nav1 C A 1: 135,607,311 probably benign Het
Nfrkb T C 9: 31,410,251 V748A probably benign Het
Obox6 A T 7: 15,834,813 M46K possibly damaging Het
Olfr1002 T C 2: 85,647,992 T110A probably benign Het
Olfr1013 G T 2: 85,770,061 E87* probably null Het
Olfr1102 C T 2: 87,002,166 R66W possibly damaging Het
Olfr172 T C 16: 58,760,742 I145V probably benign Het
Olfr820 G A 10: 130,017,547 R62Q probably damaging Het
P4htm A G 9: 108,579,772 V412A possibly damaging Het
Phb2 T C 6: 124,713,123 S92P probably damaging Het
Phtf1 G T 3: 103,987,435 R147L probably damaging Het
Pigk C T 3: 152,742,566 Q189* probably null Het
Plxnc1 G A 10: 94,867,468 probably benign Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Ptprg G A 14: 12,213,713 G252D probably damaging Het
Rnf4 G T 5: 34,350,803 V134F possibly damaging Het
Scarf2 A G 16: 17,803,013 T182A probably damaging Het
Setd1a A G 7: 127,797,330 probably benign Het
Sgpp1 A G 12: 75,734,939 F209L probably benign Het
Sh3d19 T A 3: 86,116,864 S567T possibly damaging Het
Slc4a2 C T 5: 24,434,880 R520W probably damaging Het
Slf1 T C 13: 77,046,632 Q858R probably damaging Het
Slitrk3 G T 3: 73,049,519 A640E probably benign Het
Spon1 A G 7: 114,033,071 E543G possibly damaging Het
Strn4 A G 7: 16,828,794 Q286R possibly damaging Het
Suz12 T C 11: 80,002,162 probably benign Het
Syna T A 5: 134,558,586 E503V probably damaging Het
Syt14 C T 1: 192,930,786 D569N probably damaging Het
Sytl2 A G 7: 90,381,249 probably benign Het
Tmprss11g G T 5: 86,489,232 S335* probably null Het
Tmprss11g A T 5: 86,489,233 S335T probably damaging Het
Trim66 A G 7: 109,483,069 S226P probably damaging Het
Tubgcp3 T C 8: 12,657,654 T112A probably benign Het
Ulk4 T C 9: 121,263,725 S149G probably benign Het
Usp53 T C 3: 122,962,933 D108G probably null Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Other mutations in Smarca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Smarca2 APN 19 26774294 missense possibly damaging 0.82
IGL01907:Smarca2 APN 19 26698465 missense possibly damaging 0.59
IGL02039:Smarca2 APN 19 26716137 missense probably damaging 1.00
IGL02110:Smarca2 APN 19 26672740 missense possibly damaging 0.96
IGL02561:Smarca2 APN 19 26716182 missense possibly damaging 0.92
IGL02649:Smarca2 APN 19 26640586 missense possibly damaging 0.73
IGL02880:Smarca2 APN 19 26676624 splice site probably benign
IGL03028:Smarca2 APN 19 26678312 splice site probably benign
IGL03187:Smarca2 APN 19 26672824 missense probably damaging 0.98
IGL03213:Smarca2 APN 19 26623975 missense probably damaging 1.00
IGL03354:Smarca2 APN 19 26619903 missense probably benign 0.01
FR4737:Smarca2 UTSW 19 26630999 unclassified probably benign
PIT1430001:Smarca2 UTSW 19 26649093 missense probably benign 0.35
R0184:Smarca2 UTSW 19 26692249 nonsense probably null
R0306:Smarca2 UTSW 19 26640613 missense probably damaging 1.00
R0538:Smarca2 UTSW 19 26691362 missense probably damaging 0.99
R0565:Smarca2 UTSW 19 26681875 missense possibly damaging 0.71
R0610:Smarca2 UTSW 19 26691391 missense probably damaging 1.00
R0669:Smarca2 UTSW 19 26706200 missense possibly damaging 0.51
R0726:Smarca2 UTSW 19 26698403 missense probably damaging 1.00
R1184:Smarca2 UTSW 19 26770933 splice site probably benign
R1256:Smarca2 UTSW 19 26681973 missense probably benign 0.06
R1299:Smarca2 UTSW 19 26771611 critical splice donor site probably null
R1306:Smarca2 UTSW 19 26770988 missense possibly damaging 0.81
R1381:Smarca2 UTSW 19 26630828 missense probably damaging 1.00
R1400:Smarca2 UTSW 19 26676740 missense probably damaging 0.98
R1415:Smarca2 UTSW 19 26710684 missense probably null 0.72
R1496:Smarca2 UTSW 19 26631101 missense possibly damaging 0.85
R1582:Smarca2 UTSW 19 26751905 missense probably damaging 0.99
R1666:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1668:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1751:Smarca2 UTSW 19 26640380 splice site probably benign
R1861:Smarca2 UTSW 19 26623884 missense probably benign 0.03
R1962:Smarca2 UTSW 19 26672724 nonsense probably null
R1964:Smarca2 UTSW 19 26672724 nonsense probably null
R1998:Smarca2 UTSW 19 26631093 missense probably benign 0.33
R2014:Smarca2 UTSW 19 26683905 missense possibly damaging 0.86
R2255:Smarca2 UTSW 19 26771038 missense probably benign 0.01
R2392:Smarca2 UTSW 19 26640650 critical splice donor site probably null
R2439:Smarca2 UTSW 19 26691454 critical splice donor site probably null
R3030:Smarca2 UTSW 19 26752029 missense possibly damaging 0.84
R3195:Smarca2 UTSW 19 26683822 missense possibly damaging 0.85
R3430:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R3710:Smarca2 UTSW 19 26668890 unclassified probably benign
R3845:Smarca2 UTSW 19 26720873 missense probably benign 0.06
R4013:Smarca2 UTSW 19 26683927 splice site probably null
R4014:Smarca2 UTSW 19 26683927 splice site probably null
R4016:Smarca2 UTSW 19 26683927 splice site probably null
R4271:Smarca2 UTSW 19 26720949 critical splice donor site probably null
R4471:Smarca2 UTSW 19 26619877 missense possibly damaging 0.86
R4612:Smarca2 UTSW 19 26776225 missense possibly damaging 0.70
R4755:Smarca2 UTSW 19 26654483 missense possibly damaging 0.86
R4999:Smarca2 UTSW 19 26720855 nonsense probably null
R5015:Smarca2 UTSW 19 26691388 missense possibly damaging 0.86
R5320:Smarca2 UTSW 19 26691372 missense probably damaging 1.00
R5393:Smarca2 UTSW 19 26640429 missense probably benign 0.18
R5503:Smarca2 UTSW 19 26623936 missense probably damaging 0.96
R5503:Smarca2 UTSW 19 26682046 missense possibly damaging 0.93
R5715:Smarca2 UTSW 19 26649122 missense probably benign 0.16
R5790:Smarca2 UTSW 19 26676724 missense probably damaging 1.00
R5874:Smarca2 UTSW 19 26776069 intron probably benign
R6209:Smarca2 UTSW 19 26771004 nonsense probably null
R6236:Smarca2 UTSW 19 26696213 missense probably benign 0.33
R6291:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6292:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6325:Smarca2 UTSW 19 26678363 missense probably damaging 0.99
R6544:Smarca2 UTSW 19 26630931 missense probably damaging 1.00
R6572:Smarca2 UTSW 19 26679173 missense possibly damaging 0.71
R6589:Smarca2 UTSW 19 26619884 missense possibly damaging 0.53
R6601:Smarca2 UTSW 19 26654377 missense probably benign 0.30
R6804:Smarca2 UTSW 19 26751886 missense possibly damaging 0.93
R6922:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R7047:Smarca2 UTSW 19 26669155 missense possibly damaging 0.83
X0061:Smarca2 UTSW 19 26720840 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACAACCACTCAGTTTGCC -3'
(R):5'- CAGCTGCACAGGACTGAAAG -3'

Sequencing Primer
(F):5'- ACTCAGTTTGCCTTCTAGGGTACAAG -3'
(R):5'- AGGCGAGGGACCTCTGTTAG -3'
Posted On2015-11-11