Incidental Mutation 'R4731:Pkp4'
ID358801
Institutional Source Beutler Lab
Gene Symbol Pkp4
Ensembl Gene ENSMUSG00000026991
Gene Nameplakophilin 4
SynonymsArmrp, 9430019K17Rik, 5031422I09Rik, p0071
MMRRC Submission 042021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4731 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location59160850-59355208 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 59334932 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037903] [ENSMUST00000037903] [ENSMUST00000102754] [ENSMUST00000112577] [ENSMUST00000112577] [ENSMUST00000123908] [ENSMUST00000168631] [ENSMUST00000183359] [ENSMUST00000184332]
Predicted Effect probably null
Transcript: ENSMUST00000037903
SMART Domains Protein: ENSMUSP00000042249
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
ARM 876 916 3.34e-6 SMART
ARM 964 1008 1.32e-4 SMART
low complexity region 1057 1073 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037903
SMART Domains Protein: ENSMUSP00000042249
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
ARM 876 916 3.34e-6 SMART
ARM 964 1008 1.32e-4 SMART
low complexity region 1057 1073 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102754
SMART Domains Protein: ENSMUSP00000099815
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1083 1100 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112577
SMART Domains Protein: ENSMUSP00000108196
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
low complexity region 126 137 N/A INTRINSIC
ARM 217 257 5.68e-9 SMART
ARM 261 302 1.61e-8 SMART
ARM 303 360 4.54e1 SMART
ARM 362 409 9.97e0 SMART
low complexity region 420 431 N/A INTRINSIC
ARM 519 559 3.34e-6 SMART
ARM 607 651 1.32e-4 SMART
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112577
SMART Domains Protein: ENSMUSP00000108196
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
low complexity region 126 137 N/A INTRINSIC
ARM 217 257 5.68e-9 SMART
ARM 261 302 1.61e-8 SMART
ARM 303 360 4.54e1 SMART
ARM 362 409 9.97e0 SMART
low complexity region 420 431 N/A INTRINSIC
ARM 519 559 3.34e-6 SMART
ARM 607 651 1.32e-4 SMART
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123908
SMART Domains Protein: ENSMUSP00000122152
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151452
Predicted Effect probably null
Transcript: ENSMUST00000168631
SMART Domains Protein: ENSMUSP00000129836
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1041 1057 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183359
SMART Domains Protein: ENSMUSP00000139141
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184332
Meta Mutation Damage Score 0.576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (117/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo-like proteins are characterized by a series of armadillo repeats, first defined in the Drosophila 'armadillo' gene product, that are typically 42 to 45 amino acids in length. These proteins can be divided into subfamilies based on their number of repeats, their overall sequence similarity, and the dispersion of the repeats throughout their sequences. Members of the p120(ctn)/plakophilin subfamily of Armadillo-like proteins, including CTNND1, CTNND2, PKP1, PKP2, PKP4, and ARVCF. PKP4 may be a component of desmosomal plaque and other adhesion plaques and is thought to be involved in regulating junctional plaque organization and cadherin function. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype during the observation period early in life, although abnormalities may still develop at older age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,270,662 S668C probably damaging Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
AI413582 A G 17: 27,565,270 probably benign Het
Aim2 T A 1: 173,463,876 D282E possibly damaging Het
Akap9 T A 5: 3,962,266 S990T possibly damaging Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Ankrd28 A C 14: 31,755,741 C115G probably benign Het
Anxa2 A T 9: 69,486,530 M217L probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
BC024978 T A 7: 27,201,043 M149K probably damaging Het
Btaf1 A G 19: 36,981,078 D665G probably benign Het
Ccdc36 A G 9: 108,405,385 V368A probably benign Het
Cdc42bpg T A 19: 6,311,191 V282E probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdipt T A 7: 126,978,358 L92H probably damaging Het
Cep104 T A 4: 153,988,426 D380E probably damaging Het
Cfap74 T A 4: 155,463,602 probably benign Het
Chd1 A T 17: 17,377,817 E55D probably benign Het
Cldnd2 T A 7: 43,442,189 C65S possibly damaging Het
Clec9a G T 6: 129,416,336 A108S probably benign Het
Cog7 T C 7: 121,964,244 D215G probably benign Het
Col9a3 G A 2: 180,610,681 E373K probably damaging Het
Deptor C A 15: 55,181,010 H191N probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dnah7c T A 1: 46,770,173 N3550K probably damaging Het
Dnah8 A G 17: 30,775,061 K3384R probably null Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dnhd1 C A 7: 105,673,849 N521K probably benign Het
Efhb G A 17: 53,426,244 T533I probably damaging Het
Ercc4 A T 16: 13,147,607 H701L probably damaging Het
Ern1 A T 11: 106,434,850 probably benign Het
Etfb T C 7: 43,444,200 V17A probably damaging Het
Evc T A 5: 37,323,797 M235L probably benign Het
Fbxw22 T C 9: 109,378,869 I445V probably benign Het
Fmnl2 A G 2: 53,117,069 T764A possibly damaging Het
Fto T A 8: 91,409,714 D205E probably damaging Het
Galntl6 G A 8: 58,427,813 P147L probably damaging Het
Gm6871 T C 7: 41,546,749 I39V probably benign Het
Gpr83 A G 9: 14,866,174 probably benign Het
Gucy1a2 A T 9: 3,759,424 H410L probably benign Het
Helb T C 10: 120,094,288 probably null Het
Ifi214 T C 1: 173,526,591 Q171R probably benign Het
Ifit1bl1 T C 19: 34,594,321 I245M probably benign Het
Igdcc3 A G 9: 65,181,997 T492A probably damaging Het
Ighv13-1 T C 12: 114,267,632 probably benign Het
Igkv4-50 T C 6: 69,701,000 K40R probably benign Het
Igkv8-18 T A 6: 70,356,296 I74N probably damaging Het
Kbtbd7 T C 14: 79,428,800 *691Q probably null Het
Khnyn T A 14: 55,886,489 probably null Het
Kif26a G A 12: 112,175,573 A754T probably benign Het
Llgl1 T A 11: 60,706,225 L194* probably null Het
Map3k12 G T 15: 102,501,282 T686N probably benign Het
Myo18a C A 11: 77,829,759 P741Q probably benign Het
Ncaph2 G A 15: 89,355,827 probably benign Het
Nfkb2 A G 19: 46,308,964 Q406R possibly damaging Het
Olfr1378 G A 11: 50,969,266 V83M possibly damaging Het
Olfr138 T A 17: 38,275,547 Y259N probably damaging Het
Olfr744 T A 14: 50,618,569 C116S probably benign Het
Olfr874 A T 9: 37,746,535 T134S probably benign Het
Olfr94 T C 17: 37,197,024 T315A probably damaging Het
Olfr980 A T 9: 40,006,268 I227N probably damaging Het
Ostm1 C T 10: 42,678,979 probably benign Het
Pabpc1 A T 15: 36,599,284 V389E probably benign Het
Pank4 A T 4: 154,971,390 M291L probably benign Het
Pex6 A G 17: 46,722,288 D579G probably benign Het
Pex6 A G 17: 46,724,707 probably null Het
Phc2 C T 4: 128,707,971 T73M probably damaging Het
Plekhg1 T A 10: 3,957,506 S808T probably benign Het
Plk5 A T 10: 80,358,797 H118L probably damaging Het
Pnlip T C 19: 58,676,487 I249T probably benign Het
Ptov1 T C 7: 44,867,109 D134G probably benign Het
Ptprb T C 10: 116,319,333 V664A probably benign Het
Ptprz1 T A 6: 23,002,610 S1566R probably benign Het
Pum1 T C 4: 130,718,193 S158P probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Ros1 A C 10: 52,142,229 W778G probably damaging Het
Ryr2 A T 13: 11,577,909 M4653K possibly damaging Het
Sacm1l G A 9: 123,590,830 V553I probably benign Het
Samd4b G A 7: 28,406,663 R377W probably benign Het
Selenoo A G 15: 89,099,328 Q524R probably benign Het
Slc30a3 T C 5: 31,093,294 S22G probably benign Het
Slc35g2 A C 9: 100,552,502 V372G probably benign Het
Slc5a8 T C 10: 88,925,787 probably null Het
Slc7a7 T C 14: 54,408,733 Y91C probably damaging Het
Slc7a9 T A 7: 35,453,563 Y135* probably null Het
Slfn1 A T 11: 83,121,835 E259V probably damaging Het
Slmap T C 14: 26,468,535 N156S probably damaging Het
Sorbs1 T A 19: 40,314,689 R485S probably benign Het
Sptbn2 T A 19: 4,742,480 F1388I probably damaging Het
Stac2 C T 11: 98,039,695 G349E probably damaging Het
Tigd2 T A 6: 59,211,415 H422Q probably benign Het
Tle1 T C 4: 72,125,019 N538D possibly damaging Het
Tmtc1 A C 6: 148,284,980 probably null Het
Tns3 C T 11: 8,450,986 R1104H probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trank1 T C 9: 111,390,410 F2072L probably damaging Het
Trim6 T C 7: 104,232,648 Y369H probably damaging Het
Trpc7 A G 13: 56,804,553 S541P probably damaging Het
Trpv4 T C 5: 114,622,753 D732G possibly damaging Het
Tsc2 C A 17: 24,603,275 V1141F possibly damaging Het
Tspoap1 T A 11: 87,765,647 V257E probably benign Het
Ttn A T 2: 76,943,011 M2395K unknown Het
Ubd A C 17: 37,195,702 T160P probably benign Het
Ubr7 A G 12: 102,769,226 T315A probably benign Het
Ugt2b36 G T 5: 87,081,538 Y156* probably null Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Urod G A 4: 116,991,673 A92V possibly damaging Het
Utp20 T C 10: 88,754,520 D2364G possibly damaging Het
Vmn1r87 A T 7: 13,132,327 M11K possibly damaging Het
Vstm4 A G 14: 32,917,902 K96E possibly damaging Het
Wwp1 T C 4: 19,661,990 D172G probably benign Het
Zfhx3 A G 8: 108,956,084 Q3385R unknown Het
Zfp229 C T 17: 21,745,286 H166Y possibly damaging Het
Zfp738 A T 13: 67,669,914 C653S probably damaging Het
Zp2 C A 7: 120,138,120 V282L probably damaging Het
Other mutations in Pkp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pkp4 APN 2 59338755 missense probably damaging 0.99
IGL00987:Pkp4 APN 2 59308357 missense probably damaging 0.98
IGL01321:Pkp4 APN 2 59350627 splice site probably null
IGL01393:Pkp4 APN 2 59347925 missense probably damaging 1.00
IGL02058:Pkp4 APN 2 59311729 nonsense probably null
IGL02313:Pkp4 APN 2 59310254 nonsense probably null
IGL02635:Pkp4 APN 2 59305498 unclassified probably benign
IGL03017:Pkp4 APN 2 59266425 missense probably benign 0.06
IGL03051:Pkp4 APN 2 59311762 missense probably benign 0.29
degrasso UTSW 2 59318600 missense probably damaging 1.00
melted UTSW 2 59334932 critical splice donor site probably null
R0206:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0207:Pkp4 UTSW 2 59305488 missense possibly damaging 0.89
R0208:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0325:Pkp4 UTSW 2 59318529 missense probably damaging 1.00
R0620:Pkp4 UTSW 2 59322643 missense possibly damaging 0.46
R0781:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1110:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1537:Pkp4 UTSW 2 59214803 missense probably damaging 1.00
R1607:Pkp4 UTSW 2 59322554 missense probably benign 0.00
R1654:Pkp4 UTSW 2 59337619 missense probably damaging 0.96
R1760:Pkp4 UTSW 2 59311841 missense probably damaging 0.97
R2051:Pkp4 UTSW 2 59334904 missense probably benign 0.37
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R3161:Pkp4 UTSW 2 59308105 missense probably damaging 1.00
R4261:Pkp4 UTSW 2 59305162 missense probably damaging 1.00
R4342:Pkp4 UTSW 2 59350608 missense probably damaging 0.98
R4799:Pkp4 UTSW 2 59342105 missense probably damaging 1.00
R4913:Pkp4 UTSW 2 59305450 missense probably damaging 1.00
R5383:Pkp4 UTSW 2 59310273 nonsense probably null
R5418:Pkp4 UTSW 2 59310162 missense probably benign 0.09
R5906:Pkp4 UTSW 2 59305076 missense possibly damaging 0.79
R5946:Pkp4 UTSW 2 59305067 missense probably benign 0.01
R6360:Pkp4 UTSW 2 59214747 missense probably benign 0.01
R6616:Pkp4 UTSW 2 59350552 nonsense probably null
R6817:Pkp4 UTSW 2 59318600 missense probably damaging 1.00
R7390:Pkp4 UTSW 2 59310140 missense possibly damaging 0.94
R7408:Pkp4 UTSW 2 59311766 missense probably damaging 1.00
R7464:Pkp4 UTSW 2 59308137 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCTATCTTCGTGTGATGCTGTAAAG -3'
(R):5'- AGGAGAAACTGTTGGAACTGCC -3'

Sequencing Primer
(F):5'- GATGACAATCATTCGAGACGCGC -3'
(R):5'- CAAGACAGTTGCCTTGGGG -3'
Posted On2015-11-11