Incidental Mutation 'R4731:Pum1'
ID358810
Institutional Source Beutler Lab
Gene Symbol Pum1
Ensembl Gene ENSMUSG00000028580
Gene Namepumilio RNA-binding family member 1
SynonymsPumm
MMRRC Submission 042021-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R4731 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130663321-130781564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130718193 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 158 (S158P)
Ref Sequence ENSEMBL: ENSMUSP00000095476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030315] [ENSMUST00000097862] [ENSMUST00000097864] [ENSMUST00000105991] [ENSMUST00000105992] [ENSMUST00000143277]
Predicted Effect probably benign
Transcript: ENSMUST00000030315
AA Change: S158P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030315
Gene: ENSMUSG00000028580
AA Change: S158P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 443 458 N/A INTRINSIC
low complexity region 476 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 584 615 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 643 666 N/A INTRINSIC
low complexity region 672 696 N/A INTRINSIC
low complexity region 731 741 N/A INTRINSIC
low complexity region 763 783 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Pumilio 849 884 1.75e-6 SMART
Pumilio 885 920 4.03e-6 SMART
Pumilio 921 955 5.24e-5 SMART
Pumilio 959 994 3.37e-8 SMART
Pumilio 995 1030 6.29e-8 SMART
Pumilio 1031 1066 1.04e-8 SMART
Pumilio 1067 1102 6.2e-7 SMART
Pumilio 1110 1145 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097862
AA Change: S158P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095474
Gene: ENSMUSG00000028580
AA Change: S158P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 954 5.24e-5 SMART
Pumilio 958 993 3.37e-8 SMART
Pumilio 994 1029 6.29e-8 SMART
Pumilio 1030 1065 1.04e-8 SMART
Pumilio 1066 1101 6.2e-7 SMART
Pumilio 1109 1144 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097864
AA Change: S158P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095476
Gene: ENSMUSG00000028580
AA Change: S158P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 955 5.48e-8 SMART
Pumilio 956 991 3.37e-8 SMART
Pumilio 992 1027 6.29e-8 SMART
Pumilio 1028 1063 1.04e-8 SMART
Pumilio 1064 1099 6.2e-7 SMART
Pumilio 1107 1142 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105991
SMART Domains Protein: ENSMUSP00000101612
Gene: ENSMUSG00000028580

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 341 372 N/A INTRINSIC
low complexity region 384 394 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
low complexity region 429 453 N/A INTRINSIC
low complexity region 488 498 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 555 573 N/A INTRINSIC
Pumilio 606 641 1.75e-6 SMART
Pumilio 642 677 4.03e-6 SMART
Pumilio 678 713 5.48e-8 SMART
Pumilio 714 749 3.37e-8 SMART
Pumilio 750 785 6.29e-8 SMART
Pumilio 786 821 1.04e-8 SMART
Pumilio 822 857 6.2e-7 SMART
Pumilio 865 900 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105992
SMART Domains Protein: ENSMUSP00000101613
Gene: ENSMUSG00000028580

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 297 318 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
low complexity region 379 406 N/A INTRINSIC
low complexity region 431 442 N/A INTRINSIC
low complexity region 487 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 546 569 N/A INTRINSIC
low complexity region 575 599 N/A INTRINSIC
low complexity region 634 644 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
Pumilio 752 787 1.75e-6 SMART
Pumilio 788 823 4.03e-6 SMART
Pumilio 824 858 5.24e-5 SMART
Pumilio 862 897 3.37e-8 SMART
Pumilio 898 933 6.29e-8 SMART
Pumilio 934 969 1.04e-8 SMART
Pumilio 970 1005 6.2e-7 SMART
Pumilio 1013 1048 8.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122847
Predicted Effect probably benign
Transcript: ENSMUST00000143277
SMART Domains Protein: ENSMUSP00000114629
Gene: ENSMUSG00000028580

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (117/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testes weight and size, decreased body weight, oligozoospermia, reduced male fertility, increased male germ cell apoptosis and small seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,270,662 S668C probably damaging Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
AI413582 A G 17: 27,565,270 probably benign Het
Aim2 T A 1: 173,463,876 D282E possibly damaging Het
Akap9 T A 5: 3,962,266 S990T possibly damaging Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Ankrd28 A C 14: 31,755,741 C115G probably benign Het
Anxa2 A T 9: 69,486,530 M217L probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
BC024978 T A 7: 27,201,043 M149K probably damaging Het
Btaf1 A G 19: 36,981,078 D665G probably benign Het
Ccdc36 A G 9: 108,405,385 V368A probably benign Het
Cdc42bpg T A 19: 6,311,191 V282E probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdipt T A 7: 126,978,358 L92H probably damaging Het
Cep104 T A 4: 153,988,426 D380E probably damaging Het
Cfap74 T A 4: 155,463,602 probably benign Het
Chd1 A T 17: 17,377,817 E55D probably benign Het
Cldnd2 T A 7: 43,442,189 C65S possibly damaging Het
Clec9a G T 6: 129,416,336 A108S probably benign Het
Cog7 T C 7: 121,964,244 D215G probably benign Het
Col9a3 G A 2: 180,610,681 E373K probably damaging Het
Deptor C A 15: 55,181,010 H191N probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dnah7c T A 1: 46,770,173 N3550K probably damaging Het
Dnah8 A G 17: 30,775,061 K3384R probably null Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dnhd1 C A 7: 105,673,849 N521K probably benign Het
Efhb G A 17: 53,426,244 T533I probably damaging Het
Ercc4 A T 16: 13,147,607 H701L probably damaging Het
Ern1 A T 11: 106,434,850 probably benign Het
Etfb T C 7: 43,444,200 V17A probably damaging Het
Evc T A 5: 37,323,797 M235L probably benign Het
Fbxw22 T C 9: 109,378,869 I445V probably benign Het
Fmnl2 A G 2: 53,117,069 T764A possibly damaging Het
Fto T A 8: 91,409,714 D205E probably damaging Het
Galntl6 G A 8: 58,427,813 P147L probably damaging Het
Gm6871 T C 7: 41,546,749 I39V probably benign Het
Gpr83 A G 9: 14,866,174 probably benign Het
Gucy1a2 A T 9: 3,759,424 H410L probably benign Het
Helb T C 10: 120,094,288 probably null Het
Ifi214 T C 1: 173,526,591 Q171R probably benign Het
Ifit1bl1 T C 19: 34,594,321 I245M probably benign Het
Igdcc3 A G 9: 65,181,997 T492A probably damaging Het
Ighv13-1 T C 12: 114,267,632 probably benign Het
Igkv4-50 T C 6: 69,701,000 K40R probably benign Het
Igkv8-18 T A 6: 70,356,296 I74N probably damaging Het
Kbtbd7 T C 14: 79,428,800 *691Q probably null Het
Khnyn T A 14: 55,886,489 probably null Het
Kif26a G A 12: 112,175,573 A754T probably benign Het
Llgl1 T A 11: 60,706,225 L194* probably null Het
Map3k12 G T 15: 102,501,282 T686N probably benign Het
Myo18a C A 11: 77,829,759 P741Q probably benign Het
Ncaph2 G A 15: 89,355,827 probably benign Het
Nfkb2 A G 19: 46,308,964 Q406R possibly damaging Het
Olfr1378 G A 11: 50,969,266 V83M possibly damaging Het
Olfr138 T A 17: 38,275,547 Y259N probably damaging Het
Olfr744 T A 14: 50,618,569 C116S probably benign Het
Olfr874 A T 9: 37,746,535 T134S probably benign Het
Olfr94 T C 17: 37,197,024 T315A probably damaging Het
Olfr980 A T 9: 40,006,268 I227N probably damaging Het
Ostm1 C T 10: 42,678,979 probably benign Het
Pabpc1 A T 15: 36,599,284 V389E probably benign Het
Pank4 A T 4: 154,971,390 M291L probably benign Het
Pex6 A G 17: 46,722,288 D579G probably benign Het
Pex6 A G 17: 46,724,707 probably null Het
Phc2 C T 4: 128,707,971 T73M probably damaging Het
Pkp4 G A 2: 59,334,932 probably null Het
Plekhg1 T A 10: 3,957,506 S808T probably benign Het
Plk5 A T 10: 80,358,797 H118L probably damaging Het
Pnlip T C 19: 58,676,487 I249T probably benign Het
Ptov1 T C 7: 44,867,109 D134G probably benign Het
Ptprb T C 10: 116,319,333 V664A probably benign Het
Ptprz1 T A 6: 23,002,610 S1566R probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Ros1 A C 10: 52,142,229 W778G probably damaging Het
Ryr2 A T 13: 11,577,909 M4653K possibly damaging Het
Sacm1l G A 9: 123,590,830 V553I probably benign Het
Samd4b G A 7: 28,406,663 R377W probably benign Het
Selenoo A G 15: 89,099,328 Q524R probably benign Het
Slc30a3 T C 5: 31,093,294 S22G probably benign Het
Slc35g2 A C 9: 100,552,502 V372G probably benign Het
Slc5a8 T C 10: 88,925,787 probably null Het
Slc7a7 T C 14: 54,408,733 Y91C probably damaging Het
Slc7a9 T A 7: 35,453,563 Y135* probably null Het
Slfn1 A T 11: 83,121,835 E259V probably damaging Het
Slmap T C 14: 26,468,535 N156S probably damaging Het
Sorbs1 T A 19: 40,314,689 R485S probably benign Het
Sptbn2 T A 19: 4,742,480 F1388I probably damaging Het
Stac2 C T 11: 98,039,695 G349E probably damaging Het
Tigd2 T A 6: 59,211,415 H422Q probably benign Het
Tle1 T C 4: 72,125,019 N538D possibly damaging Het
Tmtc1 A C 6: 148,284,980 probably null Het
Tns3 C T 11: 8,450,986 R1104H probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trank1 T C 9: 111,390,410 F2072L probably damaging Het
Trim6 T C 7: 104,232,648 Y369H probably damaging Het
Trpc7 A G 13: 56,804,553 S541P probably damaging Het
Trpv4 T C 5: 114,622,753 D732G possibly damaging Het
Tsc2 C A 17: 24,603,275 V1141F possibly damaging Het
Tspoap1 T A 11: 87,765,647 V257E probably benign Het
Ttn A T 2: 76,943,011 M2395K unknown Het
Ubd A C 17: 37,195,702 T160P probably benign Het
Ubr7 A G 12: 102,769,226 T315A probably benign Het
Ugt2b36 G T 5: 87,081,538 Y156* probably null Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Urod G A 4: 116,991,673 A92V possibly damaging Het
Utp20 T C 10: 88,754,520 D2364G possibly damaging Het
Vmn1r87 A T 7: 13,132,327 M11K possibly damaging Het
Vstm4 A G 14: 32,917,902 K96E possibly damaging Het
Wwp1 T C 4: 19,661,990 D172G probably benign Het
Zfhx3 A G 8: 108,956,084 Q3385R unknown Het
Zfp229 C T 17: 21,745,286 H166Y possibly damaging Het
Zfp738 A T 13: 67,669,914 C653S probably damaging Het
Zp2 C A 7: 120,138,120 V282L probably damaging Het
Other mutations in Pum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Pum1 APN 4 130743789 missense probably damaging 1.00
IGL01327:Pum1 APN 4 130730543 missense probably damaging 0.97
IGL01360:Pum1 APN 4 130728170 intron probably benign
IGL02055:Pum1 APN 4 130754054 missense probably benign 0.19
IGL02713:Pum1 APN 4 130766012 missense probably damaging 1.00
IGL03401:Pum1 APN 4 130743681 splice site probably benign
LCD18:Pum1 UTSW 4 130730549 intron probably benign
R0077:Pum1 UTSW 4 130772674 missense probably benign 0.06
R0346:Pum1 UTSW 4 130779805 missense possibly damaging 0.74
R0632:Pum1 UTSW 4 130728104 missense probably benign 0.34
R0870:Pum1 UTSW 4 130768844 missense probably damaging 0.99
R1006:Pum1 UTSW 4 130771888 missense probably damaging 0.98
R1300:Pum1 UTSW 4 130765961 missense probably damaging 1.00
R1499:Pum1 UTSW 4 130719256 missense probably damaging 1.00
R1572:Pum1 UTSW 4 130718204 missense probably damaging 0.99
R1835:Pum1 UTSW 4 130701048 missense possibly damaging 0.93
R1864:Pum1 UTSW 4 130751525 missense possibly damaging 0.90
R1991:Pum1 UTSW 4 130718218 missense possibly damaging 0.93
R2068:Pum1 UTSW 4 130774434 missense probably benign 0.02
R2119:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2120:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2122:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2153:Pum1 UTSW 4 130751491 missense probably damaging 1.00
R2164:Pum1 UTSW 4 130728083 nonsense probably null
R2164:Pum1 UTSW 4 130728084 missense probably damaging 0.99
R2280:Pum1 UTSW 4 130766011 missense probably damaging 1.00
R3116:Pum1 UTSW 4 130772660 missense probably damaging 1.00
R3890:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3891:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3892:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R4134:Pum1 UTSW 4 130764069 missense probably damaging 1.00
R4258:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R4732:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4733:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4973:Pum1 UTSW 4 130669137 missense probably benign 0.27
R5198:Pum1 UTSW 4 130779879 nonsense probably null
R5249:Pum1 UTSW 4 130762814 missense probably benign 0.07
R5478:Pum1 UTSW 4 130751484 missense possibly damaging 0.93
R5652:Pum1 UTSW 4 130764127 missense possibly damaging 0.95
R5932:Pum1 UTSW 4 130730366 missense probably benign 0.04
R6008:Pum1 UTSW 4 130768847 missense probably damaging 1.00
R6112:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R6416:Pum1 UTSW 4 130728287 unclassified probably null
R6426:Pum1 UTSW 4 130753972 missense probably damaging 1.00
R6431:Pum1 UTSW 4 130774505 missense probably damaging 1.00
R7226:Pum1 UTSW 4 130771981 missense probably damaging 1.00
R7273:Pum1 UTSW 4 130751480 missense probably damaging 0.99
R7423:Pum1 UTSW 4 130774545 missense probably damaging 1.00
R7491:Pum1 UTSW 4 130719174 missense probably benign 0.08
R7526:Pum1 UTSW 4 130747026 missense probably damaging 0.99
X0024:Pum1 UTSW 4 130779790 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAAAACACTTTGATTGAGACC -3'
(R):5'- ACATCATCTAAGCTCCTTAGTGGC -3'

Sequencing Primer
(F):5'- ACACTTTGATTGAGACCCTCAGG -3'
(R):5'- CTATAGGACAGGACATTTGCTCG -3'
Posted On2015-11-11