Incidental Mutation 'R4733:Dnah7c'
ID358911
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Namedynein, axonemal, heavy chain 7C
SynonymsDnahc7c
MMRRC Submission 042023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R4733 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location46425592-46807476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46770173 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 3550 (N3550K)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
Predicted Effect probably damaging
Transcript: ENSMUST00000189749
AA Change: N3550K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: N3550K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Meta Mutation Damage Score 0.436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 180 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,173 noncoding transcript Het
3110035E14Rik T C 1: 9,606,976 S24P probably benign Het
4933409G03Rik A G 2: 68,614,721 probably benign Het
Acan T C 7: 79,098,609 S1043P probably damaging Het
Ackr2 A G 9: 121,909,183 Y208C probably damaging Het
Adam1a T A 5: 121,519,434 T599S probably benign Het
Adamts12 A T 15: 11,270,662 S668C probably damaging Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Adgrf2 A C 17: 42,710,754 I393S probably damaging Het
Ahnak G T 19: 9,007,301 G1983V probably damaging Het
Aim2 T A 1: 173,463,876 D282E possibly damaging Het
Ak8 A G 2: 28,760,071 Y370C probably damaging Het
Akap9 A G 5: 4,013,901 D1750G probably damaging Het
Als2cl T A 9: 110,889,136 V315E probably damaging Het
Ankrd28 A C 14: 31,755,741 C115G probably benign Het
Ap3b2 C T 7: 81,471,932 A519T probably damaging Het
Apool C T X: 112,372,200 T166I probably damaging Het
Arhgef2 A T 3: 88,631,940 K65* probably null Het
Arhgef38 G T 3: 133,132,269 Y633* probably null Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atf7ip2 A G 16: 10,241,886 D430G possibly damaging Het
Atp8a1 G A 5: 67,813,120 S92L probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC024978 T A 7: 27,201,043 M149K probably damaging Het
C130073F10Rik C A 4: 101,890,710 S89I probably benign Het
Cacna1g T C 11: 94,443,215 T867A probably damaging Het
Ccdc88a T G 11: 29,485,906 N1276K probably benign Het
Cdc42bpg T A 19: 6,311,191 V282E probably damaging Het
Cdipt T A 7: 126,978,358 L92H probably damaging Het
Celsr2 T A 3: 108,398,952 D2012V probably damaging Het
Cenpt A G 8: 105,847,136 V254A probably benign Het
Cep104 T A 4: 153,988,426 D380E probably damaging Het
Cers5 C T 15: 99,741,637 R123Q probably benign Het
Ces2h A G 8: 105,014,604 E76G probably damaging Het
Cfap77 T A 2: 28,984,388 E143D probably benign Het
Chmp7 C A 14: 69,732,296 R65L probably damaging Het
Cldnd2 T A 7: 43,442,189 C65S possibly damaging Het
Clec2g C A 6: 128,981,879 Y142* probably null Het
Coch A T 12: 51,605,019 E549V probably benign Het
Cog7 T C 7: 121,964,244 D215G probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Col4a2 A G 8: 11,446,197 H1606R probably benign Het
Cpd T C 11: 76,811,794 N583D probably damaging Het
Cyp2d11 T A 15: 82,389,227 Y481F probably benign Het
D130043K22Rik T C 13: 24,899,665 S1038P probably damaging Het
Deptor C A 15: 55,181,010 H191N probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dnah12 C T 14: 26,781,784 T1653I probably damaging Het
Dnah8 A G 17: 30,775,061 K3384R probably null Het
Dnhd1 C A 7: 105,673,849 N521K probably benign Het
Drg2 T C 11: 60,461,396 probably null Het
Dync1h1 C T 12: 110,649,507 Q3030* probably null Het
Efhb G A 17: 53,426,244 T533I probably damaging Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Etfb T C 7: 43,444,200 V17A probably damaging Het
F5 C T 1: 164,181,657 T332M probably damaging Het
Fcho1 T C 8: 71,716,795 T156A probably benign Het
Fn1 A T 1: 71,602,512 probably null Het
Fnip2 A T 3: 79,481,652 S561T probably damaging Het
Frs2 T A 10: 117,074,093 T455S probably benign Het
Fry G A 5: 150,386,007 E639K possibly damaging Het
Fto T A 8: 91,409,714 D205E probably damaging Het
Galntl6 G A 8: 58,427,813 P147L probably damaging Het
Gigyf1 T A 5: 137,524,770 D844E probably benign Het
Gle1 T C 2: 29,940,232 S267P probably damaging Het
Glg1 G A 8: 111,187,755 R466W probably damaging Het
Gm10277 T C 11: 77,786,097 probably benign Het
Gm5724 A T 6: 141,723,179 M509K probably benign Het
Gm6871 T C 7: 41,546,749 I39V probably benign Het
Gpr35 T G 1: 92,983,385 I57S probably damaging Het
Gprin1 C T 13: 54,739,957 G168E possibly damaging Het
Gtf3c2 G T 5: 31,160,057 P586T probably damaging Het
Gucy1a2 A T 9: 3,759,424 H410L probably benign Het
Gucy2c A G 6: 136,767,152 S150P probably damaging Het
Ifi214 T C 1: 173,526,591 Q171R probably benign Het
Igkv4-50 T C 6: 69,701,000 K40R probably benign Het
Igkv8-18 T A 6: 70,356,296 I74N probably damaging Het
Il2ra T A 2: 11,676,920 M112K probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kbtbd7 T C 14: 79,428,800 *691Q probably null Het
Kcnn2 T A 18: 45,560,349 S331T possibly damaging Het
Khnyn T A 14: 55,886,489 probably null Het
Kif26a G A 12: 112,175,573 A754T probably benign Het
Klra3 T A 6: 130,327,132 Y199F possibly damaging Het
Lhx2 A G 2: 38,359,991 K274R probably damaging Het
Lrp2 T C 2: 69,533,555 I313V probably benign Het
Lrrfip1 A T 1: 91,115,647 E591D probably benign Het
Lrrk2 A C 15: 91,688,849 E200A probably damaging Het
Lrrk2 G A 15: 91,765,747 E1696K probably damaging Het
Mast4 A T 13: 102,772,572 M465K probably damaging Het
Moxd2 T G 6: 40,878,859 I599L probably benign Het
Mug2 T C 6: 122,071,872 S866P probably damaging Het
Ncam2 A G 16: 81,434,884 T79A possibly damaging Het
Ncoa6 C A 2: 155,421,301 Q404H probably damaging Het
Neb A G 2: 52,279,079 Y1815H probably damaging Het
Nell1 A G 7: 50,856,217 D724G probably damaging Het
Nkx3-2 A G 5: 41,762,144 V167A probably benign Het
Nsun3 C A 16: 62,735,119 C348F possibly damaging Het
Obox6 A T 7: 15,834,772 S60T possibly damaging Het
Olfr1 T C 11: 73,395,695 D109G probably benign Het
Olfr1378 G A 11: 50,969,266 V83M possibly damaging Het
Olfr138 T A 17: 38,275,547 Y259N probably damaging Het
Olfr466 T C 13: 65,152,653 V143A possibly damaging Het
Olfr744 T A 14: 50,618,569 C116S probably benign Het
Olfr94 T C 17: 37,197,024 T315A probably damaging Het
Olfr980 A T 9: 40,006,268 I227N probably damaging Het
Pabpc1 A T 15: 36,599,284 V389E probably benign Het
Pank4 A T 4: 154,971,390 M291L probably benign Het
Pcf11 T C 7: 92,658,833 D709G probably benign Het
Pcgf1 T A 6: 83,079,957 probably benign Het
Pcnx A G 12: 81,995,751 I2256V probably benign Het
Pex6 A G 17: 46,722,288 D579G probably benign Het
Pex6 A G 17: 46,724,707 probably null Het
Piezo2 C T 18: 63,030,401 A2149T probably damaging Het
Pik3c2g A G 6: 139,935,985 E781G probably benign Het
Pik3r4 G A 9: 105,678,176 V1111I possibly damaging Het
Pkd1l2 T A 8: 116,995,842 probably null Het
Plekhg1 T A 10: 3,957,506 S808T probably benign Het
Polr3c A T 3: 96,723,661 F148I probably damaging Het
Ppard A T 17: 28,286,443 T35S probably benign Het
Ptov1 T C 7: 44,867,109 D134G probably benign Het
Ptprz1 T A 6: 23,002,610 S1566R probably benign Het
Pum1 T C 4: 130,718,193 S158P probably benign Het
Qk T C 17: 10,216,288 H269R probably damaging Het
Qrsl1 T C 10: 43,876,663 Y388C probably damaging Het
Rapgef1 T G 2: 29,689,160 I182S probably damaging Het
Ret T C 6: 118,163,193 S1013G possibly damaging Het
Rimbp3 A G 16: 17,210,601 R630G possibly damaging Het
Ryr2 A T 13: 11,577,909 M4653K possibly damaging Het
Sacm1l G A 9: 123,590,830 V553I probably benign Het
Sec31b A T 19: 44,532,677 S110T probably damaging Het
Serpina3k G A 12: 104,340,860 G117D probably damaging Het
Sesn2 T C 4: 132,494,591 Y410C probably damaging Het
Slc24a1 G A 9: 64,949,554 R24C probably benign Het
Slc35g2 A C 9: 100,552,502 V372G probably benign Het
Slc7a7 T C 14: 54,408,733 Y91C probably damaging Het
Slc7a9 T A 7: 35,453,563 Y135* probably null Het
Slco4a1 A G 2: 180,473,615 N662D probably damaging Het
Slfn4 T A 11: 83,189,282 probably benign Het
Slmap T C 14: 26,468,535 N156S probably damaging Het
Snx18 A G 13: 113,617,774 S208P probably benign Het
Sorbs1 T A 19: 40,314,689 R485S probably benign Het
Spib A G 7: 44,528,885 S154P probably damaging Het
Spty2d1 T C 7: 46,996,110 D595G probably damaging Het
St7 T A 6: 17,906,516 probably null Het
Susd1 T C 4: 59,428,029 T52A possibly damaging Het
Svs2 T A 2: 164,237,123 D288V possibly damaging Het
Syt7 T A 19: 10,442,924 I355N probably damaging Het
Tarm1 G A 7: 3,496,900 Q145* probably null Het
Teddm2 T A 1: 153,850,741 E76V probably damaging Het
Thsd7b T C 1: 129,613,186 S343P probably damaging Het
Tigd2 T A 6: 59,211,415 H422Q probably benign Het
Tle1 T C 4: 72,125,019 N538D possibly damaging Het
Tmc2 A G 2: 130,261,397 probably null Het
Tmtc1 A C 6: 148,284,980 probably null Het
Tns3 C T 11: 8,450,986 R1104H probably benign Het
Trim6 T C 7: 104,232,648 Y369H probably damaging Het
Triobp G A 15: 78,967,113 R489K probably damaging Het
Trpv4 T C 5: 114,622,753 D732G possibly damaging Het
Trrap G A 5: 144,816,570 V1883I probably damaging Het
Tsc2 C A 17: 24,603,275 V1141F possibly damaging Het
Ttn A G 2: 76,899,827 probably benign Het
Ttn A T 2: 76,943,011 M2395K unknown Het
Tyrp1 A T 4: 80,844,935 D353V possibly damaging Het
Ubd A C 17: 37,195,702 T160P probably benign Het
Ugt2b36 G T 5: 87,081,538 Y156* probably null Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Unc13d A G 11: 116,073,582 V312A possibly damaging Het
Urb2 G T 8: 124,028,897 A448S probably damaging Het
Urod G A 4: 116,991,673 A92V possibly damaging Het
Vmn1r33 T A 6: 66,611,819 R250S probably benign Het
Vmn1r87 A T 7: 13,132,327 M11K possibly damaging Het
Vmn2r77 C T 7: 86,800,987 T147I probably benign Het
Vstm4 A G 14: 32,917,902 K96E possibly damaging Het
Washc4 A T 10: 83,574,479 M644L probably benign Het
Wwp1 T C 4: 19,661,990 D172G probably benign Het
Zbtb38 A T 9: 96,687,684 V449E probably damaging Het
Zfp229 C T 17: 21,745,286 H166Y possibly damaging Het
Zfp512b A G 2: 181,588,739 S453P probably benign Het
Zp2 C A 7: 120,138,120 V282L probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACATGGAGATGATTCCTTGAATC -3'
(R):5'- TCAGTAATGAAAACCAACTGTGCTG -3'

Sequencing Primer
(F):5'- GGAGATGATTCCTTGAATCTTACTC -3'
(R):5'- TAGGGGCCACTTGAATTG -3'
Posted On2015-11-11