Incidental Mutation 'R4733:Ulk4'
ID358975
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission 042023-MU
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R4733 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 121263638 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 178 (R178*)
Ref Sequence ENSEMBL: ENSMUSP00000131342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
Predicted Effect probably null
Transcript: ENSMUST00000051479
AA Change: R178*
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: R178*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect probably null
Transcript: ENSMUST00000171061
AA Change: R178*
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: R178*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171923
AA Change: R178*
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: R178*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.6164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 180 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,173 noncoding transcript Het
3110035E14Rik T C 1: 9,606,976 S24P probably benign Het
4933409G03Rik A G 2: 68,614,721 probably benign Het
Acan T C 7: 79,098,609 S1043P probably damaging Het
Ackr2 A G 9: 121,909,183 Y208C probably damaging Het
Adam1a T A 5: 121,519,434 T599S probably benign Het
Adamts12 A T 15: 11,270,662 S668C probably damaging Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Adgrf2 A C 17: 42,710,754 I393S probably damaging Het
Ahnak G T 19: 9,007,301 G1983V probably damaging Het
Aim2 T A 1: 173,463,876 D282E possibly damaging Het
Ak8 A G 2: 28,760,071 Y370C probably damaging Het
Akap9 A G 5: 4,013,901 D1750G probably damaging Het
Als2cl T A 9: 110,889,136 V315E probably damaging Het
Ankrd28 A C 14: 31,755,741 C115G probably benign Het
Ap3b2 C T 7: 81,471,932 A519T probably damaging Het
Apool C T X: 112,372,200 T166I probably damaging Het
Arhgef2 A T 3: 88,631,940 K65* probably null Het
Arhgef38 G T 3: 133,132,269 Y633* probably null Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atf7ip2 A G 16: 10,241,886 D430G possibly damaging Het
Atp8a1 G A 5: 67,813,120 S92L probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC024978 T A 7: 27,201,043 M149K probably damaging Het
C130073F10Rik C A 4: 101,890,710 S89I probably benign Het
Cacna1g T C 11: 94,443,215 T867A probably damaging Het
Ccdc88a T G 11: 29,485,906 N1276K probably benign Het
Cdc42bpg T A 19: 6,311,191 V282E probably damaging Het
Cdipt T A 7: 126,978,358 L92H probably damaging Het
Celsr2 T A 3: 108,398,952 D2012V probably damaging Het
Cenpt A G 8: 105,847,136 V254A probably benign Het
Cep104 T A 4: 153,988,426 D380E probably damaging Het
Cers5 C T 15: 99,741,637 R123Q probably benign Het
Ces2h A G 8: 105,014,604 E76G probably damaging Het
Cfap77 T A 2: 28,984,388 E143D probably benign Het
Chmp7 C A 14: 69,732,296 R65L probably damaging Het
Cldnd2 T A 7: 43,442,189 C65S possibly damaging Het
Clec2g C A 6: 128,981,879 Y142* probably null Het
Coch A T 12: 51,605,019 E549V probably benign Het
Cog7 T C 7: 121,964,244 D215G probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Col4a2 A G 8: 11,446,197 H1606R probably benign Het
Cpd T C 11: 76,811,794 N583D probably damaging Het
Cyp2d11 T A 15: 82,389,227 Y481F probably benign Het
D130043K22Rik T C 13: 24,899,665 S1038P probably damaging Het
Deptor C A 15: 55,181,010 H191N probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dnah12 C T 14: 26,781,784 T1653I probably damaging Het
Dnah7c T A 1: 46,770,173 N3550K probably damaging Het
Dnah8 A G 17: 30,775,061 K3384R probably null Het
Dnhd1 C A 7: 105,673,849 N521K probably benign Het
Drg2 T C 11: 60,461,396 probably null Het
Dync1h1 C T 12: 110,649,507 Q3030* probably null Het
Efhb G A 17: 53,426,244 T533I probably damaging Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Etfb T C 7: 43,444,200 V17A probably damaging Het
F5 C T 1: 164,181,657 T332M probably damaging Het
Fcho1 T C 8: 71,716,795 T156A probably benign Het
Fn1 A T 1: 71,602,512 probably null Het
Fnip2 A T 3: 79,481,652 S561T probably damaging Het
Frs2 T A 10: 117,074,093 T455S probably benign Het
Fry G A 5: 150,386,007 E639K possibly damaging Het
Fto T A 8: 91,409,714 D205E probably damaging Het
Galntl6 G A 8: 58,427,813 P147L probably damaging Het
Gigyf1 T A 5: 137,524,770 D844E probably benign Het
Gle1 T C 2: 29,940,232 S267P probably damaging Het
Glg1 G A 8: 111,187,755 R466W probably damaging Het
Gm10277 T C 11: 77,786,097 probably benign Het
Gm5724 A T 6: 141,723,179 M509K probably benign Het
Gm6871 T C 7: 41,546,749 I39V probably benign Het
Gpr35 T G 1: 92,983,385 I57S probably damaging Het
Gprin1 C T 13: 54,739,957 G168E possibly damaging Het
Gtf3c2 G T 5: 31,160,057 P586T probably damaging Het
Gucy1a2 A T 9: 3,759,424 H410L probably benign Het
Gucy2c A G 6: 136,767,152 S150P probably damaging Het
Ifi214 T C 1: 173,526,591 Q171R probably benign Het
Igkv4-50 T C 6: 69,701,000 K40R probably benign Het
Igkv8-18 T A 6: 70,356,296 I74N probably damaging Het
Il2ra T A 2: 11,676,920 M112K probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kbtbd7 T C 14: 79,428,800 *691Q probably null Het
Kcnn2 T A 18: 45,560,349 S331T possibly damaging Het
Khnyn T A 14: 55,886,489 probably null Het
Kif26a G A 12: 112,175,573 A754T probably benign Het
Klra3 T A 6: 130,327,132 Y199F possibly damaging Het
Lhx2 A G 2: 38,359,991 K274R probably damaging Het
Lrp2 T C 2: 69,533,555 I313V probably benign Het
Lrrfip1 A T 1: 91,115,647 E591D probably benign Het
Lrrk2 A C 15: 91,688,849 E200A probably damaging Het
Lrrk2 G A 15: 91,765,747 E1696K probably damaging Het
Mast4 A T 13: 102,772,572 M465K probably damaging Het
Moxd2 T G 6: 40,878,859 I599L probably benign Het
Mug2 T C 6: 122,071,872 S866P probably damaging Het
Ncam2 A G 16: 81,434,884 T79A possibly damaging Het
Ncoa6 C A 2: 155,421,301 Q404H probably damaging Het
Neb A G 2: 52,279,079 Y1815H probably damaging Het
Nell1 A G 7: 50,856,217 D724G probably damaging Het
Nkx3-2 A G 5: 41,762,144 V167A probably benign Het
Nsun3 C A 16: 62,735,119 C348F possibly damaging Het
Obox6 A T 7: 15,834,772 S60T possibly damaging Het
Olfr1 T C 11: 73,395,695 D109G probably benign Het
Olfr1378 G A 11: 50,969,266 V83M possibly damaging Het
Olfr138 T A 17: 38,275,547 Y259N probably damaging Het
Olfr466 T C 13: 65,152,653 V143A possibly damaging Het
Olfr744 T A 14: 50,618,569 C116S probably benign Het
Olfr94 T C 17: 37,197,024 T315A probably damaging Het
Olfr980 A T 9: 40,006,268 I227N probably damaging Het
Pabpc1 A T 15: 36,599,284 V389E probably benign Het
Pank4 A T 4: 154,971,390 M291L probably benign Het
Pcf11 T C 7: 92,658,833 D709G probably benign Het
Pcgf1 T A 6: 83,079,957 probably benign Het
Pcnx A G 12: 81,995,751 I2256V probably benign Het
Pex6 A G 17: 46,722,288 D579G probably benign Het
Pex6 A G 17: 46,724,707 probably null Het
Piezo2 C T 18: 63,030,401 A2149T probably damaging Het
Pik3c2g A G 6: 139,935,985 E781G probably benign Het
Pik3r4 G A 9: 105,678,176 V1111I possibly damaging Het
Pkd1l2 T A 8: 116,995,842 probably null Het
Plekhg1 T A 10: 3,957,506 S808T probably benign Het
Polr3c A T 3: 96,723,661 F148I probably damaging Het
Ppard A T 17: 28,286,443 T35S probably benign Het
Ptov1 T C 7: 44,867,109 D134G probably benign Het
Ptprz1 T A 6: 23,002,610 S1566R probably benign Het
Pum1 T C 4: 130,718,193 S158P probably benign Het
Qk T C 17: 10,216,288 H269R probably damaging Het
Qrsl1 T C 10: 43,876,663 Y388C probably damaging Het
Rapgef1 T G 2: 29,689,160 I182S probably damaging Het
Ret T C 6: 118,163,193 S1013G possibly damaging Het
Rimbp3 A G 16: 17,210,601 R630G possibly damaging Het
Ryr2 A T 13: 11,577,909 M4653K possibly damaging Het
Sacm1l G A 9: 123,590,830 V553I probably benign Het
Sec31b A T 19: 44,532,677 S110T probably damaging Het
Serpina3k G A 12: 104,340,860 G117D probably damaging Het
Sesn2 T C 4: 132,494,591 Y410C probably damaging Het
Slc24a1 G A 9: 64,949,554 R24C probably benign Het
Slc35g2 A C 9: 100,552,502 V372G probably benign Het
Slc7a7 T C 14: 54,408,733 Y91C probably damaging Het
Slc7a9 T A 7: 35,453,563 Y135* probably null Het
Slco4a1 A G 2: 180,473,615 N662D probably damaging Het
Slfn4 T A 11: 83,189,282 probably benign Het
Slmap T C 14: 26,468,535 N156S probably damaging Het
Snx18 A G 13: 113,617,774 S208P probably benign Het
Sorbs1 T A 19: 40,314,689 R485S probably benign Het
Spib A G 7: 44,528,885 S154P probably damaging Het
Spty2d1 T C 7: 46,996,110 D595G probably damaging Het
St7 T A 6: 17,906,516 probably null Het
Susd1 T C 4: 59,428,029 T52A possibly damaging Het
Svs2 T A 2: 164,237,123 D288V possibly damaging Het
Syt7 T A 19: 10,442,924 I355N probably damaging Het
Tarm1 G A 7: 3,496,900 Q145* probably null Het
Teddm2 T A 1: 153,850,741 E76V probably damaging Het
Thsd7b T C 1: 129,613,186 S343P probably damaging Het
Tigd2 T A 6: 59,211,415 H422Q probably benign Het
Tle1 T C 4: 72,125,019 N538D possibly damaging Het
Tmc2 A G 2: 130,261,397 probably null Het
Tmtc1 A C 6: 148,284,980 probably null Het
Tns3 C T 11: 8,450,986 R1104H probably benign Het
Trim6 T C 7: 104,232,648 Y369H probably damaging Het
Triobp G A 15: 78,967,113 R489K probably damaging Het
Trpv4 T C 5: 114,622,753 D732G possibly damaging Het
Trrap G A 5: 144,816,570 V1883I probably damaging Het
Tsc2 C A 17: 24,603,275 V1141F possibly damaging Het
Ttn A G 2: 76,899,827 probably benign Het
Ttn A T 2: 76,943,011 M2395K unknown Het
Tyrp1 A T 4: 80,844,935 D353V possibly damaging Het
Ubd A C 17: 37,195,702 T160P probably benign Het
Ugt2b36 G T 5: 87,081,538 Y156* probably null Het
Unc13d A G 11: 116,073,582 V312A possibly damaging Het
Urb2 G T 8: 124,028,897 A448S probably damaging Het
Urod G A 4: 116,991,673 A92V possibly damaging Het
Vmn1r33 T A 6: 66,611,819 R250S probably benign Het
Vmn1r87 A T 7: 13,132,327 M11K possibly damaging Het
Vmn2r77 C T 7: 86,800,987 T147I probably benign Het
Vstm4 A G 14: 32,917,902 K96E possibly damaging Het
Washc4 A T 10: 83,574,479 M644L probably benign Het
Wwp1 T C 4: 19,661,990 D172G probably benign Het
Zbtb38 A T 9: 96,687,684 V449E probably damaging Het
Zfp229 C T 17: 21,745,286 H166Y possibly damaging Het
Zfp512b A G 2: 181,588,739 S453P probably benign Het
Zp2 C A 7: 120,138,120 V282L probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCACATTGTCCAAGAC -3'
(R):5'- TCTGAGCCGTGACAGAACAAG -3'

Sequencing Primer
(F):5'- CAAGACCTCTTGTGCTGACAC -3'
(R):5'- CCCTGTGAGGCCTGAATTG -3'
Posted On2015-11-11