Incidental Mutation 'R0332:Aox3'
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Namealdehyde oxidase 3
SynonymsAOH1, 1200011D03Rik
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0332 (G1)
Quality Score225
Status Validated
Chromosomal Location58113130-58200698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58142751 bp
Amino Acid Change Asparagine to Serine at position 299 (N299S)
Ref Sequence ENSEMBL: ENSMUSP00000049391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999] [ENSMUST00000162011]
PDB Structure
Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000040999
AA Change: N299S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: N299S

Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162011
SMART Domains Protein: ENSMUSP00000140140
Gene: ENSMUSG00000064294

Pfam:Fer2 12 82 3.6e-8 PFAM
Pfam:Fer2_2 91 166 2.5e-29 PFAM
transmembrane domain 242 264 N/A INTRINSIC
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58169794 missense probably damaging 1.00
IGL01747:Aox3 APN 1 58159658 missense probably damaging 0.97
IGL01883:Aox3 APN 1 58138283 missense probably damaging 1.00
IGL01911:Aox3 APN 1 58152560 missense probably benign 0.04
IGL02017:Aox3 APN 1 58120992 missense probably damaging 1.00
IGL02120:Aox3 APN 1 58127650 missense probably benign 0.00
IGL02466:Aox3 APN 1 58158272 missense probably benign 0.28
IGL02545:Aox3 APN 1 58183486 missense probably damaging 1.00
IGL02572:Aox3 APN 1 58158367 missense probably damaging 1.00
IGL02746:Aox3 APN 1 58183542 missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58142700 missense probably damaging 0.99
IGL02812:Aox3 APN 1 58165896 missense probably benign 0.00
IGL02982:Aox3 APN 1 58127687 missense probably benign 0.00
IGL03056:Aox3 APN 1 58159021 critical splice donor site probably null
IGL03182:Aox3 APN 1 58165887 missense probably benign 0.02
IGL03234:Aox3 APN 1 58152686 missense probably benign
IGL03374:Aox3 APN 1 58171848 missense probably damaging 1.00
amber UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0135:Aox3 UTSW 1 58125088 splice site probably benign
R0626:Aox3 UTSW 1 58172299 missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58176567 nonsense probably null
R1435:Aox3 UTSW 1 58163446 critical splice donor site probably null
R1438:Aox3 UTSW 1 58153178 missense probably benign
R1567:Aox3 UTSW 1 58194693 missense probably damaging 0.96
R1575:Aox3 UTSW 1 58152554 missense probably benign 0.04
R1759:Aox3 UTSW 1 58170646 splice site probably null
R1785:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1786:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1921:Aox3 UTSW 1 58180651 missense probably damaging 1.00
R1984:Aox3 UTSW 1 58153061 missense possibly damaging 0.88
R2012:Aox3 UTSW 1 58138232 missense probably benign 0.02
R2080:Aox3 UTSW 1 58186280 missense probably benign 0.06
R2121:Aox3 UTSW 1 58152549 splice site probably benign
R2126:Aox3 UTSW 1 58158216 missense probably benign 0.25
R2130:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2131:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2132:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2133:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2385:Aox3 UTSW 1 58138289 missense probably damaging 1.00
R2495:Aox3 UTSW 1 58188408 missense probably damaging 0.99
R4200:Aox3 UTSW 1 58188378 missense probably damaging 1.00
R4231:Aox3 UTSW 1 58114885 missense probably benign 0.12
R4591:Aox3 UTSW 1 58152656 missense probably damaging 0.99
R4627:Aox3 UTSW 1 58125035 missense probably damaging 0.98
R4831:Aox3 UTSW 1 58152566 missense probably damaging 0.97
R4864:Aox3 UTSW 1 58176487 missense probably damaging 1.00
R4976:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5007:Aox3 UTSW 1 58163424 missense probably benign
R5119:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5175:Aox3 UTSW 1 58172328 missense probably benign 0.01
R5360:Aox3 UTSW 1 58146508 missense probably damaging 1.00
R5784:Aox3 UTSW 1 58153499 missense probably benign 0.00
R6050:Aox3 UTSW 1 58180655 missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58169859 missense probably damaging 1.00
R6162:Aox3 UTSW 1 58159731 missense possibly damaging 0.75
R6181:Aox3 UTSW 1 58158946 missense probably benign 0.03
R6374:Aox3 UTSW 1 58172161 missense probably benign 0.11
R6662:Aox3 UTSW 1 58118615 missense probably damaging 1.00
R6809:Aox3 UTSW 1 58118681 missense probably damaging 0.99
R6810:Aox3 UTSW 1 58141431 missense probably benign 0.00
R6821:Aox3 UTSW 1 58150388 missense probably benign 0.04
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aaaccctccaattccagtctc -3'
Posted On2013-05-09