Incidental Mutation 'R4733:Ryr2'
ID358995
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Nameryanodine receptor 2, cardiac
Synonyms9330127I20Rik
MMRRC Submission 042023-MU
Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4733 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location11553102-12106945 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11577909 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 4653 (M4653K)
Ref Sequence ENSEMBL: ENSMUSP00000127991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021750
AA Change: M4653K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: M4653K

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170156
AA Change: M4653K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: M4653K

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222788
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 180 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,173 noncoding transcript Het
3110035E14Rik T C 1: 9,606,976 S24P probably benign Het
4933409G03Rik A G 2: 68,614,721 probably benign Het
Acan T C 7: 79,098,609 S1043P probably damaging Het
Ackr2 A G 9: 121,909,183 Y208C probably damaging Het
Adam1a T A 5: 121,519,434 T599S probably benign Het
Adamts12 A T 15: 11,270,662 S668C probably damaging Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Adgrf2 A C 17: 42,710,754 I393S probably damaging Het
Ahnak G T 19: 9,007,301 G1983V probably damaging Het
Aim2 T A 1: 173,463,876 D282E possibly damaging Het
Ak8 A G 2: 28,760,071 Y370C probably damaging Het
Akap9 A G 5: 4,013,901 D1750G probably damaging Het
Als2cl T A 9: 110,889,136 V315E probably damaging Het
Ankrd28 A C 14: 31,755,741 C115G probably benign Het
Ap3b2 C T 7: 81,471,932 A519T probably damaging Het
Apool C T X: 112,372,200 T166I probably damaging Het
Arhgef2 A T 3: 88,631,940 K65* probably null Het
Arhgef38 G T 3: 133,132,269 Y633* probably null Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atf7ip2 A G 16: 10,241,886 D430G possibly damaging Het
Atp8a1 G A 5: 67,813,120 S92L probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC024978 T A 7: 27,201,043 M149K probably damaging Het
C130073F10Rik C A 4: 101,890,710 S89I probably benign Het
Cacna1g T C 11: 94,443,215 T867A probably damaging Het
Ccdc88a T G 11: 29,485,906 N1276K probably benign Het
Cdc42bpg T A 19: 6,311,191 V282E probably damaging Het
Cdipt T A 7: 126,978,358 L92H probably damaging Het
Celsr2 T A 3: 108,398,952 D2012V probably damaging Het
Cenpt A G 8: 105,847,136 V254A probably benign Het
Cep104 T A 4: 153,988,426 D380E probably damaging Het
Cers5 C T 15: 99,741,637 R123Q probably benign Het
Ces2h A G 8: 105,014,604 E76G probably damaging Het
Cfap77 T A 2: 28,984,388 E143D probably benign Het
Chmp7 C A 14: 69,732,296 R65L probably damaging Het
Cldnd2 T A 7: 43,442,189 C65S possibly damaging Het
Clec2g C A 6: 128,981,879 Y142* probably null Het
Coch A T 12: 51,605,019 E549V probably benign Het
Cog7 T C 7: 121,964,244 D215G probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Col4a2 A G 8: 11,446,197 H1606R probably benign Het
Cpd T C 11: 76,811,794 N583D probably damaging Het
Cyp2d11 T A 15: 82,389,227 Y481F probably benign Het
D130043K22Rik T C 13: 24,899,665 S1038P probably damaging Het
Deptor C A 15: 55,181,010 H191N probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dnah12 C T 14: 26,781,784 T1653I probably damaging Het
Dnah7c T A 1: 46,770,173 N3550K probably damaging Het
Dnah8 A G 17: 30,775,061 K3384R probably null Het
Dnhd1 C A 7: 105,673,849 N521K probably benign Het
Drg2 T C 11: 60,461,396 probably null Het
Dync1h1 C T 12: 110,649,507 Q3030* probably null Het
Efhb G A 17: 53,426,244 T533I probably damaging Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Etfb T C 7: 43,444,200 V17A probably damaging Het
F5 C T 1: 164,181,657 T332M probably damaging Het
Fcho1 T C 8: 71,716,795 T156A probably benign Het
Fn1 A T 1: 71,602,512 probably null Het
Fnip2 A T 3: 79,481,652 S561T probably damaging Het
Frs2 T A 10: 117,074,093 T455S probably benign Het
Fry G A 5: 150,386,007 E639K possibly damaging Het
Fto T A 8: 91,409,714 D205E probably damaging Het
Galntl6 G A 8: 58,427,813 P147L probably damaging Het
Gigyf1 T A 5: 137,524,770 D844E probably benign Het
Gle1 T C 2: 29,940,232 S267P probably damaging Het
Glg1 G A 8: 111,187,755 R466W probably damaging Het
Gm10277 T C 11: 77,786,097 probably benign Het
Gm5724 A T 6: 141,723,179 M509K probably benign Het
Gm6871 T C 7: 41,546,749 I39V probably benign Het
Gpr35 T G 1: 92,983,385 I57S probably damaging Het
Gprin1 C T 13: 54,739,957 G168E possibly damaging Het
Gtf3c2 G T 5: 31,160,057 P586T probably damaging Het
Gucy1a2 A T 9: 3,759,424 H410L probably benign Het
Gucy2c A G 6: 136,767,152 S150P probably damaging Het
Ifi214 T C 1: 173,526,591 Q171R probably benign Het
Igkv4-50 T C 6: 69,701,000 K40R probably benign Het
Igkv8-18 T A 6: 70,356,296 I74N probably damaging Het
Il2ra T A 2: 11,676,920 M112K probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kbtbd7 T C 14: 79,428,800 *691Q probably null Het
Kcnn2 T A 18: 45,560,349 S331T possibly damaging Het
Khnyn T A 14: 55,886,489 probably null Het
Kif26a G A 12: 112,175,573 A754T probably benign Het
Klra3 T A 6: 130,327,132 Y199F possibly damaging Het
Lhx2 A G 2: 38,359,991 K274R probably damaging Het
Lrp2 T C 2: 69,533,555 I313V probably benign Het
Lrrfip1 A T 1: 91,115,647 E591D probably benign Het
Lrrk2 A C 15: 91,688,849 E200A probably damaging Het
Lrrk2 G A 15: 91,765,747 E1696K probably damaging Het
Mast4 A T 13: 102,772,572 M465K probably damaging Het
Moxd2 T G 6: 40,878,859 I599L probably benign Het
Mug2 T C 6: 122,071,872 S866P probably damaging Het
Ncam2 A G 16: 81,434,884 T79A possibly damaging Het
Ncoa6 C A 2: 155,421,301 Q404H probably damaging Het
Neb A G 2: 52,279,079 Y1815H probably damaging Het
Nell1 A G 7: 50,856,217 D724G probably damaging Het
Nkx3-2 A G 5: 41,762,144 V167A probably benign Het
Nsun3 C A 16: 62,735,119 C348F possibly damaging Het
Obox6 A T 7: 15,834,772 S60T possibly damaging Het
Olfr1 T C 11: 73,395,695 D109G probably benign Het
Olfr1378 G A 11: 50,969,266 V83M possibly damaging Het
Olfr138 T A 17: 38,275,547 Y259N probably damaging Het
Olfr466 T C 13: 65,152,653 V143A possibly damaging Het
Olfr744 T A 14: 50,618,569 C116S probably benign Het
Olfr94 T C 17: 37,197,024 T315A probably damaging Het
Olfr980 A T 9: 40,006,268 I227N probably damaging Het
Pabpc1 A T 15: 36,599,284 V389E probably benign Het
Pank4 A T 4: 154,971,390 M291L probably benign Het
Pcf11 T C 7: 92,658,833 D709G probably benign Het
Pcgf1 T A 6: 83,079,957 probably benign Het
Pcnx A G 12: 81,995,751 I2256V probably benign Het
Pex6 A G 17: 46,722,288 D579G probably benign Het
Pex6 A G 17: 46,724,707 probably null Het
Piezo2 C T 18: 63,030,401 A2149T probably damaging Het
Pik3c2g A G 6: 139,935,985 E781G probably benign Het
Pik3r4 G A 9: 105,678,176 V1111I possibly damaging Het
Pkd1l2 T A 8: 116,995,842 probably null Het
Plekhg1 T A 10: 3,957,506 S808T probably benign Het
Polr3c A T 3: 96,723,661 F148I probably damaging Het
Ppard A T 17: 28,286,443 T35S probably benign Het
Ptov1 T C 7: 44,867,109 D134G probably benign Het
Ptprz1 T A 6: 23,002,610 S1566R probably benign Het
Pum1 T C 4: 130,718,193 S158P probably benign Het
Qk T C 17: 10,216,288 H269R probably damaging Het
Qrsl1 T C 10: 43,876,663 Y388C probably damaging Het
Rapgef1 T G 2: 29,689,160 I182S probably damaging Het
Ret T C 6: 118,163,193 S1013G possibly damaging Het
Rimbp3 A G 16: 17,210,601 R630G possibly damaging Het
Sacm1l G A 9: 123,590,830 V553I probably benign Het
Sec31b A T 19: 44,532,677 S110T probably damaging Het
Serpina3k G A 12: 104,340,860 G117D probably damaging Het
Sesn2 T C 4: 132,494,591 Y410C probably damaging Het
Slc24a1 G A 9: 64,949,554 R24C probably benign Het
Slc35g2 A C 9: 100,552,502 V372G probably benign Het
Slc7a7 T C 14: 54,408,733 Y91C probably damaging Het
Slc7a9 T A 7: 35,453,563 Y135* probably null Het
Slco4a1 A G 2: 180,473,615 N662D probably damaging Het
Slfn4 T A 11: 83,189,282 probably benign Het
Slmap T C 14: 26,468,535 N156S probably damaging Het
Snx18 A G 13: 113,617,774 S208P probably benign Het
Sorbs1 T A 19: 40,314,689 R485S probably benign Het
Spib A G 7: 44,528,885 S154P probably damaging Het
Spty2d1 T C 7: 46,996,110 D595G probably damaging Het
St7 T A 6: 17,906,516 probably null Het
Susd1 T C 4: 59,428,029 T52A possibly damaging Het
Svs2 T A 2: 164,237,123 D288V possibly damaging Het
Syt7 T A 19: 10,442,924 I355N probably damaging Het
Tarm1 G A 7: 3,496,900 Q145* probably null Het
Teddm2 T A 1: 153,850,741 E76V probably damaging Het
Thsd7b T C 1: 129,613,186 S343P probably damaging Het
Tigd2 T A 6: 59,211,415 H422Q probably benign Het
Tle1 T C 4: 72,125,019 N538D possibly damaging Het
Tmc2 A G 2: 130,261,397 probably null Het
Tmtc1 A C 6: 148,284,980 probably null Het
Tns3 C T 11: 8,450,986 R1104H probably benign Het
Trim6 T C 7: 104,232,648 Y369H probably damaging Het
Triobp G A 15: 78,967,113 R489K probably damaging Het
Trpv4 T C 5: 114,622,753 D732G possibly damaging Het
Trrap G A 5: 144,816,570 V1883I probably damaging Het
Tsc2 C A 17: 24,603,275 V1141F possibly damaging Het
Ttn A G 2: 76,899,827 probably benign Het
Ttn A T 2: 76,943,011 M2395K unknown Het
Tyrp1 A T 4: 80,844,935 D353V possibly damaging Het
Ubd A C 17: 37,195,702 T160P probably benign Het
Ugt2b36 G T 5: 87,081,538 Y156* probably null Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Unc13d A G 11: 116,073,582 V312A possibly damaging Het
Urb2 G T 8: 124,028,897 A448S probably damaging Het
Urod G A 4: 116,991,673 A92V possibly damaging Het
Vmn1r33 T A 6: 66,611,819 R250S probably benign Het
Vmn1r87 A T 7: 13,132,327 M11K possibly damaging Het
Vmn2r77 C T 7: 86,800,987 T147I probably benign Het
Vstm4 A G 14: 32,917,902 K96E possibly damaging Het
Washc4 A T 10: 83,574,479 M644L probably benign Het
Wwp1 T C 4: 19,661,990 D172G probably benign Het
Zbtb38 A T 9: 96,687,684 V449E probably damaging Het
Zfp229 C T 17: 21,745,286 H166Y possibly damaging Het
Zfp512b A G 2: 181,588,739 S453P probably benign Het
Zp2 C A 7: 120,138,120 V282L probably damaging Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11834092 splice site probably benign
IGL00757:Ryr2 APN 13 11618604 splice site probably null
IGL00838:Ryr2 APN 13 11568503 missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11585478 missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11735502 missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11703544 missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11638485 critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11587239 missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11556685 missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11591352 missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11742036 missense probably benign 0.10
IGL01419:Ryr2 APN 13 11799837 missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11851204 missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11721790 missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11721761 missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11601758 critical splice donor site probably null
IGL01611:Ryr2 APN 13 11591316 missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11594968 missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11692677 missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11585480 missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11601842 missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11595425 missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11554550 missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11597112 missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11747564 missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11572257 missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11792762 nonsense probably null
IGL02086:Ryr2 APN 13 11735556 missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11759759 missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11737873 missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11741869 missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11730388 missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11747658 splice site probably benign
IGL02369:Ryr2 APN 13 11619496 missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11722721 splice site probably benign
IGL02400:Ryr2 APN 13 11605244 splice site probably benign
IGL02423:Ryr2 APN 13 11745198 missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11745674 missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11705699 missense probably benign 0.15
IGL02602:Ryr2 APN 13 11554511 utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11605189 missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11738320 missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11655677 missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11595190 missense probably benign 0.21
IGL02876:Ryr2 APN 13 11707793 missense probably benign 0.39
IGL02878:Ryr2 APN 13 11918319 missense probably benign 0.10
IGL02887:Ryr2 APN 13 11591269 missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11759835 missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11684479 missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11643902 critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11635582 splice site probably benign
IGL03152:Ryr2 APN 13 11853150 missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11742023 nonsense probably null
IGL03180:Ryr2 APN 13 11568563 missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11724387 splice site probably benign
IGL03390:Ryr2 APN 13 11772416 missense probably benign
IGL03410:Ryr2 APN 13 11588147 missense probably damaging 0.99
Arruda UTSW 13 11643895 missense probably damaging 1.00
arruda2 UTSW 13 11879496 missense probably damaging 1.00
arruda3 UTSW 13 11555448 missense possibly damaging 0.91
H8562:Ryr2 UTSW 13 11717141 splice site probably benign
IGL02799:Ryr2 UTSW 13 11665962 missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11761306 missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11707796 missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11594755 missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11555448 missense probably benign 0.29
R0003:Ryr2 UTSW 13 11824379 missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11665919 missense probably benign
R0018:Ryr2 UTSW 13 11595223 missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11669038 missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0080:Ryr2 UTSW 13 11568475 missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11709921 missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11714548 missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11676251 splice site probably benign
R0226:Ryr2 UTSW 13 11772556 missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11716977 missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11668839 missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11705684 missense probably benign 0.45
R0415:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11834095 splice site probably benign
R0558:Ryr2 UTSW 13 11638443 missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11799861 missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11731669 missense probably benign 0.02
R0586:Ryr2 UTSW 13 11635559 missense probably null
R0601:Ryr2 UTSW 13 11705633 critical splice donor site probably null
R0610:Ryr2 UTSW 13 11622952 missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11724333 missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11566885 missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11738126 missense probably benign 0.35
R0884:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11669969 missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11945981 missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11660113 missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11883043 critical splice donor site probably null
R1296:Ryr2 UTSW 13 11687879 splice site probably benign
R1400:Ryr2 UTSW 13 11595076 missense probably benign 0.08
R1439:Ryr2 UTSW 13 11714503 splice site probably benign
R1443:Ryr2 UTSW 13 11779266 missense probably benign 0.19
R1446:Ryr2 UTSW 13 11738149 missense probably benign 0.09
R1458:Ryr2 UTSW 13 11727022 missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11601841 missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11554592 missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11554549 nonsense probably null
R1551:Ryr2 UTSW 13 11785143 critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11759677 missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11794563 missense probably benign 0.01
R1645:Ryr2 UTSW 13 11718482 nonsense probably null
R1686:Ryr2 UTSW 13 11603779 splice site probably benign
R1696:Ryr2 UTSW 13 11731657 missense probably benign 0.02
R1708:Ryr2 UTSW 13 11587442 splice site probably null
R1728:Ryr2 UTSW 13 11587422 missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11790267 missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1776:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1783:Ryr2 UTSW 13 11700371 nonsense probably null
R1801:Ryr2 UTSW 13 11595281 missense probably benign 0.01
R1812:Ryr2 UTSW 13 11560586 missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11587316 missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11769878 missense probably benign 0.06
R1868:Ryr2 UTSW 13 11731700 missense probably benign 0.02
R1869:Ryr2 UTSW 13 11662075 missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11738356 missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11658958 nonsense probably null
R1897:Ryr2 UTSW 13 11750932 missense probably benign 0.09
R1899:Ryr2 UTSW 13 11591336 missense probably benign
R1909:Ryr2 UTSW 13 11700349 missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11556698 missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11668962 missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11731723 missense probably benign 0.10
R1956:Ryr2 UTSW 13 11681080 missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11585402 splice site probably null
R2018:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11595736 missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11665878 splice site probably null
R2088:Ryr2 UTSW 13 11662229 missense probably benign 0.04
R2089:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2127:Ryr2 UTSW 13 11712195 missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11560607 missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11577873 missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11705793 nonsense probably null
R2207:Ryr2 UTSW 13 11810937 missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11662260 missense probably benign 0.18
R2258:Ryr2 UTSW 13 11738216 missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11738242 missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11591237 missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11801848 missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11772580 critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11588159 missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11738209 missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11772427 missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11918414 missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11692682 missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11779267 missense probably benign 0.22
R4127:Ryr2 UTSW 13 11587437 missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11737873 missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11750725 missense probably benign 0.20
R4355:Ryr2 UTSW 13 11649812 missense probably benign 0.05
R4384:Ryr2 UTSW 13 11605233 missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11717066 nonsense probably null
R4430:Ryr2 UTSW 13 11735527 missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12106415 missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11749509 missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11750685 splice site probably null
R4668:Ryr2 UTSW 13 11593117 missense probably benign
R4677:Ryr2 UTSW 13 11706667 missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11824369 missense probably benign 0.34
R4680:Ryr2 UTSW 13 11595233 missense probably benign 0.04
R4685:Ryr2 UTSW 13 11692646 missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11716998 missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11737753 missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11657047 missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11717097 missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11655698 missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11668820 missense probably damaging 0.99
R4850:Ryr2 UTSW 13 11745752 missense probably damaging 1.00
R4880:Ryr2 UTSW 13 11752218 missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11709963 missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11945945 missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11742011 missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11785080 missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4964:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4966:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4997:Ryr2 UTSW 13 11595306 missense probably benign 0.09
R4998:Ryr2 UTSW 13 11643895 missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11587254 missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11635536 missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11700354 missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11712243 nonsense probably null
R5135:Ryr2 UTSW 13 11662130 missense probably benign 0.05
R5138:Ryr2 UTSW 13 11660289 missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11752321 missense probably benign
R5187:Ryr2 UTSW 13 11772452 missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11638430 critical splice donor site probably null
R5262:Ryr2 UTSW 13 11772437 missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11690363 missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11556658 missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11655713 missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11705656 missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11705701 missense probably null 0.15
R5509:Ryr2 UTSW 13 11745601 missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11687909 missense probably benign 0.01
R5571:Ryr2 UTSW 13 11555448 missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11595014 missense probably benign 0.06
R5619:Ryr2 UTSW 13 11708202 missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11601805 missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11595582 missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11759836 missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11769962 missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11603732 missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11560574 missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11584154 missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11790332 missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11687902 missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11660122 missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11726953 missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11662238 nonsense probably null
R5974:Ryr2 UTSW 13 11714511 splice site probably null
R6104:Ryr2 UTSW 13 11799825 missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11792689 missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11669017 missense probably benign
R6208:Ryr2 UTSW 13 11895220 missense probably benign 0.04
R6217:Ryr2 UTSW 13 11834078 missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11660107 missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11879496 missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11761396 missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11662383 missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11834007 missense probably benign 0.29
R6548:Ryr2 UTSW 13 11668821 missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6623:Ryr2 UTSW 13 11710065 missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11595643 missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6770:Ryr2 UTSW 13 11738462 missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11686966 missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11726930 missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11829654 missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11827559 missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11745601 missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11566948 missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11801243 missense probably benign 0.28
R6997:Ryr2 UTSW 13 11654380 missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11712166 missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11794605 missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11824400 missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11649776 missense probably benign 0.10
R7125:Ryr2 UTSW 13 11669987 missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11655713 missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11640327 missense possibly damaging 0.63
R7131:Ryr2 UTSW 13 11668811 critical splice donor site probably null
R7159:Ryr2 UTSW 13 11810908 missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11801177 missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11686978 missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11759757 missense probably benign
R7189:Ryr2 UTSW 13 11883123 missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11665913 missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11597146 missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11738194 missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11745631 missense probably benign
R7365:Ryr2 UTSW 13 11640275 missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11785111 missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11735620 missense probably damaging 0.97
R7425:Ryr2 UTSW 13 11705644 missense probably benign 0.20
R7444:Ryr2 UTSW 13 11555463 missense probably benign 0.25
R7456:Ryr2 UTSW 13 11752282 missense probably benign
R7460:Ryr2 UTSW 13 11705710 missense probably benign 0.10
R7474:Ryr2 UTSW 13 11594876 missense probably benign 0.04
S24628:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11703501 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAAATGCGTCCCTTGTCCC -3'
(R):5'- ATCACAGCAGTCTTTCCTGTGC -3'

Sequencing Primer
(F):5'- CCATCCCATGTAAGGCAGAAGTG -3'
(R):5'- GCCTCCCTTACTAAGAGGGGTATC -3'
Posted On2015-11-11