Incidental Mutation 'R4732:F5'
ID359030
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Namecoagulation factor V
SynonymsCf-5, Cf5
MMRRC Submission 042022-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4732 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164151838-164220277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164181657 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 332 (T332M)
Ref Sequence ENSEMBL: ENSMUSP00000083204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040]
Predicted Effect probably damaging
Transcript: ENSMUST00000086040
AA Change: T332M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: T332M

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 99% (110/111)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 192 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,173 noncoding transcript Het
3110035E14Rik T C 1: 9,606,976 S24P probably benign Het
4933409G03Rik A G 2: 68,614,721 probably benign Het
Acan T C 7: 79,098,609 S1043P probably damaging Het
Ackr2 A G 9: 121,909,183 Y208C probably damaging Het
Actg1 C T 11: 120,347,479 probably benign Het
Adam1a T A 5: 121,519,434 T599S probably benign Het
Adamts12 A T 15: 11,270,662 S668C probably damaging Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Adgrf2 A C 17: 42,710,754 I393S probably damaging Het
Ahnak G T 19: 9,007,301 G1983V probably damaging Het
AI413582 A G 17: 27,565,270 probably benign Het
Aim2 T A 1: 173,463,876 D282E possibly damaging Het
Ak8 A G 2: 28,760,071 Y370C probably damaging Het
Akap9 A G 5: 4,013,901 D1750G probably damaging Het
Als2cl T A 9: 110,889,136 V315E probably damaging Het
Ankrd28 A C 14: 31,755,741 C115G probably benign Het
Ap3b2 C T 7: 81,471,932 A519T probably damaging Het
Apool C T X: 112,372,200 T166I probably damaging Het
Arhgef2 A T 3: 88,631,940 K65* probably null Het
Arhgef38 G T 3: 133,132,269 Y633* probably null Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atf7ip2 A G 16: 10,241,886 D430G possibly damaging Het
Atp8a1 G A 5: 67,813,120 S92L probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC024978 T A 7: 27,201,043 M149K probably damaging Het
C130073F10Rik C A 4: 101,890,710 S89I probably benign Het
Cacna1g T C 11: 94,443,215 T867A probably damaging Het
Ccdc88a T G 11: 29,485,906 N1276K probably benign Het
Cdc42bpg T A 19: 6,311,191 V282E probably damaging Het
Cdipt T A 7: 126,978,358 L92H probably damaging Het
Celsr2 T A 3: 108,398,952 D2012V probably damaging Het
Cenpt A G 8: 105,847,136 V254A probably benign Het
Cep104 T A 4: 153,988,426 D380E probably damaging Het
Cers5 C T 15: 99,741,637 R123Q probably benign Het
Ces2h A G 8: 105,014,604 E76G probably damaging Het
Cfap77 T A 2: 28,984,388 E143D probably benign Het
Chmp7 C A 14: 69,732,296 R65L probably damaging Het
Cldnd2 T A 7: 43,442,189 C65S possibly damaging Het
Clec2g C A 6: 128,981,879 Y142* probably null Het
Coch A T 12: 51,605,019 E549V probably benign Het
Cog7 T C 7: 121,964,244 D215G probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Col4a2 A G 8: 11,446,197 H1606R probably benign Het
Cpd T C 11: 76,811,794 N583D probably damaging Het
Cyp2d11 T A 15: 82,389,227 Y481F probably benign Het
D130043K22Rik T C 13: 24,899,665 S1038P probably damaging Het
Deptor C A 15: 55,181,010 H191N probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dnah12 C T 14: 26,781,784 T1653I probably damaging Het
Dnah7c T A 1: 46,770,173 N3550K probably damaging Het
Dnah8 A G 17: 30,775,061 K3384R probably null Het
Dnajc11 A G 4: 151,970,967 probably benign Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dnhd1 C A 7: 105,673,849 N521K probably benign Het
Drg2 T C 11: 60,461,396 probably null Het
Dync1h1 C T 12: 110,649,507 Q3030* probably null Het
Efhb G A 17: 53,426,244 T533I probably damaging Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Etfb T C 7: 43,444,200 V17A probably damaging Het
Fcho1 T C 8: 71,716,795 T156A probably benign Het
Fn1 A T 1: 71,602,512 probably null Het
Fnip2 A T 3: 79,481,652 S561T probably damaging Het
Frs2 T A 10: 117,074,093 T455S probably benign Het
Fry G A 5: 150,386,007 E639K possibly damaging Het
Fto T A 8: 91,409,714 D205E probably damaging Het
Galntl6 G A 8: 58,427,813 P147L probably damaging Het
Gigyf1 T A 5: 137,524,770 D844E probably benign Het
Gle1 T C 2: 29,940,232 S267P probably damaging Het
Glg1 G A 8: 111,187,755 R466W probably damaging Het
Gm10277 T C 11: 77,786,097 probably benign Het
Gm20388 A G 8: 122,270,274 probably benign Het
Gm5724 A T 6: 141,723,179 M509K probably benign Het
Gm6871 T C 7: 41,546,749 I39V probably benign Het
Gm9970 A G 5: 31,241,066 probably benign Het
Gpr35 T G 1: 92,983,385 I57S probably damaging Het
Gprin1 C T 13: 54,739,957 G168E possibly damaging Het
Gtdc1 A G 2: 44,789,055 probably benign Het
Gtf3c2 G T 5: 31,160,057 P586T probably damaging Het
Gucy1a2 A T 9: 3,759,424 H410L probably benign Het
Gucy2c A G 6: 136,767,152 S150P probably damaging Het
Ifi214 T C 1: 173,526,591 Q171R probably benign Het
Ifit1bl1 T C 19: 34,594,321 I245M probably benign Het
Igkv4-50 T C 6: 69,701,000 K40R probably benign Het
Igkv8-18 T A 6: 70,356,296 I74N probably damaging Het
Il2ra T A 2: 11,676,920 M112K probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kbtbd7 T C 14: 79,428,800 *691Q probably null Het
Kcnn2 T A 18: 45,560,349 S331T possibly damaging Het
Khnyn T A 14: 55,886,489 probably null Het
Kif26a G A 12: 112,175,573 A754T probably benign Het
Klra3 T A 6: 130,327,132 Y199F possibly damaging Het
Lhx2 A G 2: 38,359,991 K274R probably damaging Het
Lrp2 T C 2: 69,533,555 I313V probably benign Het
Lrrfip1 A T 1: 91,115,647 E591D probably benign Het
Lrrk2 A C 15: 91,688,849 E200A probably damaging Het
Lrrk2 G A 15: 91,765,747 E1696K probably damaging Het
Mast4 A T 13: 102,772,572 M465K probably damaging Het
Moxd2 T G 6: 40,878,859 I599L probably benign Het
Mug2 T C 6: 122,071,872 S866P probably damaging Het
Ncam2 A G 16: 81,434,884 T79A possibly damaging Het
Ncoa6 C A 2: 155,421,301 Q404H probably damaging Het
Neb A G 2: 52,279,079 Y1815H probably damaging Het
Nell1 A G 7: 50,856,217 D724G probably damaging Het
Nkx3-2 A G 5: 41,762,144 V167A probably benign Het
Nsun3 C A 16: 62,735,119 C348F possibly damaging Het
Obox6 A T 7: 15,834,772 S60T possibly damaging Het
Olfr1 T C 11: 73,395,695 D109G probably benign Het
Olfr1378 G A 11: 50,969,266 V83M possibly damaging Het
Olfr138 T A 17: 38,275,547 Y259N probably damaging Het
Olfr466 T C 13: 65,152,653 V143A possibly damaging Het
Olfr744 T A 14: 50,618,569 C116S probably benign Het
Olfr94 T C 17: 37,197,024 T315A probably damaging Het
Olfr980 A T 9: 40,006,268 I227N probably damaging Het
Oog2 T A 4: 144,193,941 probably benign Het
Pabpc1 A T 15: 36,599,284 V389E probably benign Het
Pank4 A T 4: 154,971,390 M291L probably benign Het
Pcf11 T C 7: 92,658,833 D709G probably benign Het
Pcgf1 T A 6: 83,079,957 probably benign Het
Pcnx A G 12: 81,995,751 I2256V probably benign Het
Pex6 A G 17: 46,722,288 D579G probably benign Het
Pex6 A G 17: 46,724,707 probably null Het
Piezo2 C T 18: 63,030,401 A2149T probably damaging Het
Pik3c2g A G 6: 139,935,985 E781G probably benign Het
Pik3r4 G A 9: 105,678,176 V1111I possibly damaging Het
Pkd1l2 T A 8: 116,995,842 probably null Het
Plekhg1 T A 10: 3,957,506 S808T probably benign Het
Pnkp T A 7: 44,860,454 probably benign Het
Polr3c A T 3: 96,723,661 F148I probably damaging Het
Ppard A T 17: 28,286,443 T35S probably benign Het
Ptov1 T C 7: 44,867,109 D134G probably benign Het
Ptprz1 T A 6: 23,002,610 S1566R probably benign Het
Pum1 T C 4: 130,718,193 S158P probably benign Het
Qk T C 17: 10,216,288 H269R probably damaging Het
Qrsl1 T C 10: 43,876,663 Y388C probably damaging Het
Rapgef1 T G 2: 29,689,160 I182S probably damaging Het
Ret T C 6: 118,163,193 S1013G possibly damaging Het
Rimbp3 A G 16: 17,210,601 R630G possibly damaging Het
Rnmt A T 18: 68,317,960 probably benign Het
Ryr2 A T 13: 11,577,909 M4653K possibly damaging Het
Sacm1l G A 9: 123,590,830 V553I probably benign Het
Sec31b A T 19: 44,532,677 S110T probably damaging Het
Serpina3k G A 12: 104,340,860 G117D probably damaging Het
Sesn2 T C 4: 132,494,591 Y410C probably damaging Het
Slc24a1 G A 9: 64,949,554 R24C probably benign Het
Slc35g2 A C 9: 100,552,502 V372G probably benign Het
Slc7a7 T C 14: 54,408,733 Y91C probably damaging Het
Slc7a9 T A 7: 35,453,563 Y135* probably null Het
Slco4a1 A G 2: 180,473,615 N662D probably damaging Het
Slfn4 T A 11: 83,189,282 probably benign Het
Slmap T C 14: 26,468,535 N156S probably damaging Het
Snx18 A G 13: 113,617,774 S208P probably benign Het
Sorbs1 T A 19: 40,314,689 R485S probably benign Het
Spib A G 7: 44,528,885 S154P probably damaging Het
Spty2d1 T C 7: 46,996,110 D595G probably damaging Het
St7 T A 6: 17,906,516 probably null Het
Susd1 T C 4: 59,428,029 T52A possibly damaging Het
Svs2 T A 2: 164,237,123 D288V possibly damaging Het
Syt7 T A 19: 10,442,924 I355N probably damaging Het
Tarm1 G A 7: 3,496,900 Q145* probably null Het
Teddm2 T A 1: 153,850,741 E76V probably damaging Het
Thsd7b T C 1: 129,613,186 S343P probably damaging Het
Tigd2 T A 6: 59,211,415 H422Q probably benign Het
Tle1 T C 4: 72,125,019 N538D possibly damaging Het
Tmc2 A G 2: 130,261,397 probably null Het
Tmtc1 A C 6: 148,284,980 probably null Het
Tns3 C T 11: 8,450,986 R1104H probably benign Het
Trim6 T C 7: 104,232,648 Y369H probably damaging Het
Triobp G A 15: 78,967,113 R489K probably damaging Het
Trpv4 T C 5: 114,622,753 D732G possibly damaging Het
Trrap G A 5: 144,816,570 V1883I probably damaging Het
Tsc2 C A 17: 24,603,275 V1141F possibly damaging Het
Ttn A T 2: 76,943,011 M2395K unknown Het
Ttn A G 2: 76,899,827 probably benign Het
Tyrp1 A T 4: 80,844,935 D353V possibly damaging Het
Ubd A C 17: 37,195,702 T160P probably benign Het
Ugt2b36 G T 5: 87,081,538 Y156* probably null Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Unc13d A G 11: 116,073,582 V312A possibly damaging Het
Urb2 G T 8: 124,028,897 A448S probably damaging Het
Urod G A 4: 116,991,673 A92V possibly damaging Het
Vmn1r33 T A 6: 66,611,819 R250S probably benign Het
Vmn1r87 A T 7: 13,132,327 M11K possibly damaging Het
Vmn2r77 C T 7: 86,800,987 T147I probably benign Het
Vstm4 A G 14: 32,917,902 K96E possibly damaging Het
Washc4 A T 10: 83,574,479 M644L probably benign Het
Wwp1 T C 4: 19,661,990 D172G probably benign Het
Zbtb38 A T 9: 96,687,684 V449E probably damaging Het
Zfhx4 T C 3: 5,214,807 probably benign Het
Zfp229 C T 17: 21,745,286 H166Y possibly damaging Het
Zfp512b A G 2: 181,588,739 S453P probably benign Het
Zp2 C A 7: 120,138,120 V282L probably damaging Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164179524 missense probably benign 0.15
IGL00843:F5 APN 1 164211791 missense probably benign 0.00
IGL00904:F5 APN 1 164194009 missense probably benign
IGL00913:F5 APN 1 164204896 missense probably damaging 1.00
IGL01099:F5 APN 1 164194334 missense probably damaging 0.99
IGL01134:F5 APN 1 164191979 missense possibly damaging 0.87
IGL01313:F5 APN 1 164193612 missense probably benign 0.01
IGL01635:F5 APN 1 164207858 missense probably benign 0.00
IGL01697:F5 APN 1 164194052 missense probably benign 0.04
IGL01768:F5 APN 1 164176345 missense probably benign 0.22
IGL01795:F5 APN 1 164194390 missense probably benign 0.00
IGL01835:F5 APN 1 164194368 missense probably benign 0.12
IGL01843:F5 APN 1 164211826 missense probably benign 0.05
IGL01989:F5 APN 1 164176307 missense probably benign 0.39
IGL02036:F5 APN 1 164183002 splice site probably benign
IGL02065:F5 APN 1 164190126 missense probably damaging 1.00
IGL02077:F5 APN 1 164198866 missense probably damaging 1.00
IGL02139:F5 APN 1 164192674 missense possibly damaging 0.89
IGL02210:F5 APN 1 164190141 missense probably benign 0.00
IGL02415:F5 APN 1 164191929 missense probably damaging 1.00
IGL02440:F5 APN 1 164207066 missense possibly damaging 0.79
IGL02471:F5 APN 1 164174291 missense probably damaging 1.00
IGL02535:F5 APN 1 164198733 missense probably damaging 0.98
IGL02537:F5 APN 1 164193117 missense probably benign 0.26
IGL02628:F5 APN 1 164194075 missense probably damaging 0.99
IGL02638:F5 APN 1 164184608 critical splice donor site probably null
IGL02824:F5 APN 1 164194347 missense probably benign 0.00
IGL02977:F5 APN 1 164194021 missense probably damaging 1.00
IGL03028:F5 APN 1 164193000 nonsense probably null
IGL03064:F5 APN 1 164195594 missense probably benign 0.04
IGL03127:F5 APN 1 164193538 missense probably benign 0.45
IGL03131:F5 APN 1 164161819 missense possibly damaging 0.62
IGL03348:F5 APN 1 164194152 missense possibly damaging 0.49
IGL03387:F5 APN 1 164193232 missense probably damaging 1.00
James_dean UTSW 1 164204820 missense probably benign 0.43
R0002:F5 UTSW 1 164201631 missense probably damaging 1.00
R0095:F5 UTSW 1 164191968 nonsense probably null
R0116:F5 UTSW 1 164184914 missense probably benign 0.01
R0359:F5 UTSW 1 164179449 missense probably damaging 1.00
R0426:F5 UTSW 1 164182840 missense probably damaging 0.99
R0452:F5 UTSW 1 164185107 missense probably damaging 0.99
R0457:F5 UTSW 1 164194200 missense probably benign 0.00
R0520:F5 UTSW 1 164209587 missense probably benign 0.15
R0522:F5 UTSW 1 164211763 missense probably damaging 1.00
R0554:F5 UTSW 1 164179449 missense probably damaging 1.00
R0575:F5 UTSW 1 164176244 missense probably damaging 1.00
R0734:F5 UTSW 1 164198917 missense probably damaging 1.00
R0739:F5 UTSW 1 164198917 missense probably damaging 1.00
R1062:F5 UTSW 1 164198917 missense probably damaging 1.00
R1063:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1150:F5 UTSW 1 164198917 missense probably damaging 1.00
R1151:F5 UTSW 1 164198917 missense probably damaging 1.00
R1152:F5 UTSW 1 164198917 missense probably damaging 1.00
R1221:F5 UTSW 1 164161799 missense probably damaging 1.00
R1284:F5 UTSW 1 164198917 missense probably damaging 1.00
R1286:F5 UTSW 1 164198917 missense probably damaging 1.00
R1358:F5 UTSW 1 164198917 missense probably damaging 1.00
R1360:F5 UTSW 1 164198917 missense probably damaging 1.00
R1362:F5 UTSW 1 164198917 missense probably damaging 1.00
R1383:F5 UTSW 1 164198917 missense probably damaging 1.00
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1545:F5 UTSW 1 164208960 nonsense probably null
R1561:F5 UTSW 1 164186903 nonsense probably null
R1623:F5 UTSW 1 164195622 missense probably damaging 1.00
R1662:F5 UTSW 1 164207888 missense probably damaging 1.00
R1673:F5 UTSW 1 164179520 missense probably damaging 1.00
R1689:F5 UTSW 1 164198917 missense probably damaging 1.00
R1705:F5 UTSW 1 164217490 missense possibly damaging 0.92
R1732:F5 UTSW 1 164174150 missense probably damaging 1.00
R1763:F5 UTSW 1 164192535 missense probably benign 0.04
R1774:F5 UTSW 1 164192535 missense probably benign 0.04
R1799:F5 UTSW 1 164193531 missense possibly damaging 0.58
R1800:F5 UTSW 1 164182834 missense probably damaging 1.00
R1842:F5 UTSW 1 164184560 missense probably damaging 0.99
R1915:F5 UTSW 1 164182917 missense probably damaging 0.97
R1926:F5 UTSW 1 164179508 missense probably damaging 1.00
R2025:F5 UTSW 1 164209475 missense probably benign 0.05
R2198:F5 UTSW 1 164207034 missense probably damaging 1.00
R2258:F5 UTSW 1 164192181 missense probably damaging 1.00
R2264:F5 UTSW 1 164194402 missense probably benign 0.32
R2281:F5 UTSW 1 164195720 missense possibly damaging 0.80
R2407:F5 UTSW 1 164211872 missense probably damaging 1.00
R2445:F5 UTSW 1 164190226 missense probably damaging 1.00
R2860:F5 UTSW 1 164184964 missense probably damaging 1.00
R2861:F5 UTSW 1 164184964 missense probably damaging 1.00
R2862:F5 UTSW 1 164184964 missense probably damaging 1.00
R2899:F5 UTSW 1 164186900 missense possibly damaging 0.88
R2910:F5 UTSW 1 164204820 missense probably benign 0.43
R2912:F5 UTSW 1 164193919 missense probably damaging 0.98
R2996:F5 UTSW 1 164182917 missense probably damaging 0.97
R3745:F5 UTSW 1 164186779 missense possibly damaging 0.79
R3901:F5 UTSW 1 164176229 missense probably benign 0.08
R3902:F5 UTSW 1 164176229 missense probably benign 0.08
R4365:F5 UTSW 1 164184950 missense probably damaging 0.98
R4448:F5 UTSW 1 164198899 missense possibly damaging 0.52
R4490:F5 UTSW 1 164217395 missense probably benign 0.40
R4514:F5 UTSW 1 164151997 unclassified probably benign
R4598:F5 UTSW 1 164204797 missense probably benign 0.05
R4608:F5 UTSW 1 164209029 missense probably benign 0.12
R4661:F5 UTSW 1 164184920 missense probably damaging 1.00
R4667:F5 UTSW 1 164174186 missense probably benign 0.00
R4689:F5 UTSW 1 164151973 unclassified probably benign
R4716:F5 UTSW 1 164193919 missense probably damaging 0.98
R4733:F5 UTSW 1 164181657 missense probably damaging 1.00
R4854:F5 UTSW 1 164192146 missense probably damaging 1.00
R4908:F5 UTSW 1 164211820 missense probably damaging 1.00
R4971:F5 UTSW 1 164194186 missense probably benign
R5001:F5 UTSW 1 164195570 missense probably benign 0.00
R5042:F5 UTSW 1 164219451 missense probably damaging 1.00
R5056:F5 UTSW 1 164192032 missense possibly damaging 0.60
R5061:F5 UTSW 1 164194180 missense probably benign 0.00
R5143:F5 UTSW 1 164211828 missense probably damaging 0.98
R5622:F5 UTSW 1 164192565 missense probably benign 0.09
R5626:F5 UTSW 1 164209035 missense probably damaging 0.98
R5658:F5 UTSW 1 164192338 missense probably damaging 0.96
R5702:F5 UTSW 1 164194547 nonsense probably null
R5795:F5 UTSW 1 164152009 missense probably benign 0.09
R5884:F5 UTSW 1 164195646 missense probably benign 0.01
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6151:F5 UTSW 1 164181635 missense probably damaging 1.00
R6151:F5 UTSW 1 164190187 missense probably damaging 1.00
R6345:F5 UTSW 1 164191951 missense probably benign 0.13
R6391:F5 UTSW 1 164193493 missense probably damaging 0.99
R6542:F5 UTSW 1 164194468 missense probably benign 0.32
R6620:F5 UTSW 1 164186806 missense probably damaging 1.00
R6750:F5 UTSW 1 164193507 missense possibly damaging 0.58
R6754:F5 UTSW 1 164193763 missense probably damaging 1.00
R6774:F5 UTSW 1 164186878 missense probably damaging 1.00
R6802:F5 UTSW 1 164179356 missense probably damaging 0.98
R6810:F5 UTSW 1 164186902 missense probably damaging 1.00
R6983:F5 UTSW 1 164194129 missense probably damaging 1.00
R7000:F5 UTSW 1 164179506 missense probably damaging 1.00
R7151:F5 UTSW 1 164201661 missense probably damaging 1.00
X0024:F5 UTSW 1 164192988 missense probably damaging 1.00
Z1088:F5 UTSW 1 164154385 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAAGACTGTCTGAGCATTGCTG -3'
(R):5'- CTACCTTAAGAGCTGGCCACTC -3'

Sequencing Primer
(F):5'- TGAGCATTGCTGTCTCCTG -3'
(R):5'- GCTGGCCACTCATGACATCATAATTG -3'
Posted On2015-11-11