Incidental Mutation 'R0332:Cstf3'
ID35905
Institutional Source Beutler Lab
Gene Symbol Cstf3
Ensembl Gene ENSMUSG00000027176
Gene Namecleavage stimulation factor, 3' pre-RNA, subunit 3
Synonyms4732468G05Rik
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0332 (G1)
Quality Score194
Status Validated
Chromosome2
Chromosomal Location104590523-104665429 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 104646467 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028599]
PDB Structure
Crystal Structure of the HAT-C domain of murine CstF-77 [X-RAY DIFFRACTION]
Crystal structure of HAT domain of murine CstF-77 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000028599
SMART Domains Protein: ENSMUSP00000028599
Gene: ENSMUSG00000027176

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
HAT 45 77 4.67e-8 SMART
HAT 79 110 5.04e-4 SMART
HAT 117 152 1.38e-1 SMART
HAT 163 196 4.39e-4 SMART
HAT 229 261 1.19e0 SMART
HAT 271 303 9.12e0 SMART
HAT 319 352 2.73e0 SMART
HAT 354 387 7.31e-1 SMART
HAT 424 456 2.37e0 SMART
HAT 458 494 1.46e0 SMART
low complexity region 597 619 N/A INTRINSIC
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Cstf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:Cstf3 APN 2 104646631 missense probably damaging 1.00
IGL02734:Cstf3 APN 2 104609194 splice site probably benign
IGL03025:Cstf3 APN 2 104608931 missense possibly damaging 0.82
R0043:Cstf3 UTSW 2 104645085 splice site probably benign
R0189:Cstf3 UTSW 2 104652446 missense probably damaging 1.00
R0499:Cstf3 UTSW 2 104649605 missense possibly damaging 0.95
R1476:Cstf3 UTSW 2 104648219 missense possibly damaging 0.82
R1677:Cstf3 UTSW 2 104664278 intron probably benign
R1881:Cstf3 UTSW 2 104654218 missense probably benign
R1916:Cstf3 UTSW 2 104655756 missense possibly damaging 0.90
R3720:Cstf3 UTSW 2 104653086 splice site probably benign
R3813:Cstf3 UTSW 2 104609121 missense probably damaging 1.00
R5155:Cstf3 UTSW 2 104652485 missense probably benign
R5304:Cstf3 UTSW 2 104663390 nonsense probably null
R5564:Cstf3 UTSW 2 104609002 intron probably benign
R5869:Cstf3 UTSW 2 104659240 intron probably null
R6172:Cstf3 UTSW 2 104651642 missense probably damaging 1.00
R6747:Cstf3 UTSW 2 104646767 missense probably damaging 1.00
R6841:Cstf3 UTSW 2 104655731 missense probably benign 0.22
R6959:Cstf3 UTSW 2 104649462 missense probably benign
X0013:Cstf3 UTSW 2 104659277 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GCCTGTCTTCAGTGACTCTAACTTGG -3'
(R):5'- ACACAACCTCGTTGATAAACTCTTCGG -3'

Sequencing Primer
(F):5'- ccaggctgcccttgaac -3'
(R):5'- GTTGATAAACTCTTCGGACAGCAG -3'
Posted On2013-05-09