Incidental Mutation 'R0332:Ptgis'
ID35908
Institutional Source Beutler Lab
Gene Symbol Ptgis
Ensembl Gene ENSMUSG00000017969
Gene Nameprostaglandin I2 (prostacyclin) synthase
SynonymsCyp8a1, Pgis, Pgi2
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R0332 (G1)
Quality Score205
Status Validated
Chromosome2
Chromosomal Location167191805-167240604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 167214833 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 278 (L278Q)
Ref Sequence ENSEMBL: ENSMUSP00000085357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018113] [ENSMUST00000088041]
Predicted Effect probably damaging
Transcript: ENSMUST00000018113
AA Change: L278Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018113
Gene: ENSMUSG00000017969
AA Change: L278Q

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 495 8.6e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088041
AA Change: L278Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085357
Gene: ENSMUSG00000017969
AA Change: L278Q

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 496 1.9e-37 PFAM
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to prostacyclin (prostaglandin I2), a potent vasodilator and inhibitor of platelet aggregation. An imbalance of prostacyclin and its physiological antagonist thromboxane A2 contribute to the development of myocardial infarction, stroke, and atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased blood urea nitrogen and creatinine levels, thickening of the aorta with age, mildly increased blood pressure, and kidney abnormalities including cysts, fibrosis, necrosis, and renal vascular congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Ptgis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01562:Ptgis APN 2 167206830 missense probably damaging 1.00
IGL01859:Ptgis APN 2 167214806 critical splice donor site probably null
IGL01965:Ptgis APN 2 167208253 missense probably benign 0.00
IGL02102:Ptgis APN 2 167225447 missense probably damaging 0.99
IGL02296:Ptgis APN 2 167206737 missense probably damaging 1.00
IGL02434:Ptgis APN 2 167240342 critical splice donor site probably null
PIT4142001:Ptgis UTSW 2 167206830 missense probably damaging 1.00
R0614:Ptgis UTSW 2 167206882 missense probably damaging 1.00
R1733:Ptgis UTSW 2 167191968 unclassified probably benign
R1756:Ptgis UTSW 2 167206803 missense probably damaging 1.00
R1779:Ptgis UTSW 2 167214858 missense probably benign 0.01
R2004:Ptgis UTSW 2 167214849 missense possibly damaging 0.94
R2019:Ptgis UTSW 2 167208279 missense probably damaging 1.00
R2019:Ptgis UTSW 2 167214810 nonsense probably null
R2512:Ptgis UTSW 2 167207276 missense probably damaging 0.99
R2679:Ptgis UTSW 2 167208193 missense probably benign 0.38
R4962:Ptgis UTSW 2 167225274 critical splice donor site probably null
R5174:Ptgis UTSW 2 167203470 critical splice acceptor site probably null
R5471:Ptgis UTSW 2 167224119 missense probably benign 0.03
R5717:Ptgis UTSW 2 167208364 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTCCAAAGCCACTGGACGAG -3'
(R):5'- CTAGGCAACTCTTACAGGGCATCAC -3'

Sequencing Primer
(F):5'- GCCACTGGACGAGAGAAAC -3'
(R):5'- AGGCTGTCCTATCAGTGACAC -3'
Posted On2013-05-09