Incidental Mutation 'R0332:Hspb8'
ID35913
Institutional Source Beutler Lab
Gene Symbol Hspb8
Ensembl Gene ENSMUSG00000041548
Gene Nameheat shock protein 8
SynonymsH11K, E2IG1, HSP20-like, HSP22, Cryac, D5Ucla4, H11
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R0332 (G1)
Quality Score199
Status Validated
Chromosome5
Chromosomal Location116408491-116422864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116409473 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 150 (D150V)
Ref Sequence ENSEMBL: ENSMUSP00000037007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036991]
Predicted Effect probably damaging
Transcript: ENSMUST00000036991
AA Change: D150V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037007
Gene: ENSMUSG00000041548
AA Change: D150V

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Pfam:HSP20 93 180 4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133335
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the superfamily of small heat-shock proteins containing a conservative alpha-crystallin domain at the C-terminal part of the molecule. The expression of this gene in induced by estrogen in estrogen receptor-positive breast cancer cells, and this protein also functions as a chaperone in association with Bag3, a stimulator of macroautophagy. Thus, this gene appears to be involved in regulation of cell proliferation, apoptosis, and carcinogenesis, and mutations in this gene have been associated with different neuromuscular diseases, including Charcot-Marie-Tooth disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: When exposed to pressure overload, mice homozygous for a knock-out allele develop less hypertrophy and display ventricular dilation, impaired contractile function, increased myocyte length and accumulation of interstitial collagen, accelerated transitioninto heart failure, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Hspb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03308:Hspb8 APN 5 116409342 missense possibly damaging 0.86
R4037:Hspb8 UTSW 5 116409344 missense probably benign 0.01
R4039:Hspb8 UTSW 5 116409344 missense probably benign 0.01
R5100:Hspb8 UTSW 5 116415409 missense probably damaging 1.00
R5256:Hspb8 UTSW 5 116409473 missense probably damaging 1.00
R6376:Hspb8 UTSW 5 116409432 missense probably damaging 1.00
R6476:Hspb8 UTSW 5 116422398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCGTCACCCTGTGGAGAAATC -3'
(R):5'- TCAAAGTTCCGGTCTGGCAAGG -3'

Sequencing Primer
(F):5'- AGTGCTGCTAAAGTAGTGTACCC -3'
(R):5'- acacacacaaatacacacatacac -3'
Posted On2013-05-09