Incidental Mutation 'R4734:Ddr2'
ID359130
Institutional Source Beutler Lab
Gene Symbol Ddr2
Ensembl Gene ENSMUSG00000026674
Gene Namediscoidin domain receptor family, member 2
SynonymsNtrkr3
MMRRC Submission 041961-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4734 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location169972307-170110762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 169998088 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 314 (E314D)
Ref Sequence ENSEMBL: ENSMUSP00000141443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027985] [ENSMUST00000170800] [ENSMUST00000194690]
Predicted Effect probably benign
Transcript: ENSMUST00000027985
AA Change: E314D

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027985
Gene: ENSMUSG00000026674
AA Change: E314D

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170800
AA Change: E314D

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129624
Gene: ENSMUSG00000026674
AA Change: E314D

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194690
AA Change: E314D

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141443
Gene: ENSMUSG00000026674
AA Change: E314D

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, reduced chondrocyte proliferation, shortened long bones and snout, and skull anomalies. Homozygotes for another null allele show similar skeletal defects, small hearts, short cardiomyocytes, lower cardiac collagen density, and altered cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,417 M86K possibly damaging Het
2700062C07Rik A G 18: 24,470,904 M1V probably null Het
Abcb11 T A 2: 69,323,962 T87S possibly damaging Het
Arap3 A G 18: 37,996,275 V210A probably benign Het
Avl9 T C 6: 56,736,494 S246P probably damaging Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Chsy3 C A 18: 59,179,413 F319L probably benign Het
Coro2b T C 9: 62,426,578 T345A probably benign Het
Cpb1 A G 3: 20,263,712 V216A probably benign Het
Cyp2c65 A G 19: 39,072,334 I213V probably benign Het
Dcaf15 A G 8: 84,097,728 C586R probably benign Het
Dennd5a C T 7: 109,896,336 R1196H probably damaging Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dpf2 A G 19: 5,906,999 probably null Het
Eif2ak4 A T 2: 118,422,087 H302L probably damaging Het
Eif2d G T 1: 131,165,152 R399L probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Fhod3 T A 18: 25,028,135 Y575N probably benign Het
Fscb T C 12: 64,474,470 E74G possibly damaging Het
Gdpd2 G A X: 100,734,193 M243I possibly damaging Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gm281 T C 14: 13,845,292 N540S probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Gnl2 T C 4: 125,041,018 F156L probably benign Het
Gpr37 C A 6: 25,689,086 R4L possibly damaging Het
Hectd4 A T 5: 121,341,977 H2892L possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Impact T A 18: 12,985,289 H188Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnx2 C T 5: 147,029,137 G391R probably damaging Het
Lrrc19 T C 4: 94,638,349 I324V probably benign Het
Lrrcc1 G T 3: 14,562,285 Q458H probably damaging Het
Maml3 A T 3: 51,689,875 D483E probably damaging Het
Mef2c T A 13: 83,662,629 *467R probably null Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Myt1l T C 12: 29,919,926 I143T possibly damaging Het
Nuggc T C 14: 65,623,230 Y426H probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr464 T A 11: 87,914,190 T239S probably damaging Het
Olfr470 T C 7: 107,845,428 I102V probably benign Het
Olfr491 A T 7: 108,317,752 N286I probably damaging Het
Olfr566 A G 7: 102,856,979 I101T probably damaging Het
Oog2 T C 4: 144,196,451 S429P probably benign Het
Pcnt T C 10: 76,437,206 D93G probably benign Het
Pdia5 A T 16: 35,456,513 M95K probably benign Het
Pdzrn4 A T 15: 92,770,252 R762* probably null Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Ppil3 A G 1: 58,431,269 Y141H probably benign Het
Rassf8 G T 6: 145,815,540 K197N probably benign Het
Ryr2 T C 13: 11,737,753 Q1894R probably damaging Het
Ryr3 T A 2: 112,910,502 N487Y probably damaging Het
Scn5a T C 9: 119,539,538 Y307C probably damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Shroom1 C T 11: 53,465,233 S370F probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc2a9 C A 5: 38,382,099 G353C probably damaging Het
Snx33 T A 9: 56,925,901 T295S possibly damaging Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Supt6 T C 11: 78,224,683 D761G probably benign Het
Tfeb T C 17: 47,785,862 V18A probably benign Het
Thap12 G T 7: 98,715,954 C443F probably damaging Het
Thap12 T A 7: 98,715,955 C443* probably null Het
Tmem67 T C 4: 12,063,158 D496G probably benign Het
Trappc8 G A 18: 20,841,572 R900* probably null Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Trmt1l A T 1: 151,442,637 I80L probably benign Het
Trpm5 C A 7: 143,082,785 V472L probably benign Het
Tspear C T 10: 77,864,695 L120F probably damaging Het
Ttc9b G A 7: 27,656,018 V238M probably benign Het
Usp20 A G 2: 31,019,824 I819V probably benign Het
Vmn2r102 T A 17: 19,677,533 V270E probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Other mutations in Ddr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ddr2 APN 1 169984427 missense possibly damaging 0.95
IGL00432:Ddr2 APN 1 169997958 missense probably benign 0.11
IGL00490:Ddr2 APN 1 170005194 missense probably damaging 1.00
IGL01343:Ddr2 APN 1 169984581 missense probably benign
IGL01898:Ddr2 APN 1 169998156 missense possibly damaging 0.85
IGL01899:Ddr2 APN 1 169984422 missense probably damaging 1.00
IGL01906:Ddr2 APN 1 169982099 missense probably damaging 1.00
IGL02115:Ddr2 APN 1 169994709 missense probably benign
IGL02330:Ddr2 APN 1 169988524 missense probably damaging 0.99
IGL02740:Ddr2 APN 1 169984945 missense probably damaging 1.00
IGL02828:Ddr2 APN 1 169988513 missense probably benign 0.34
fibro UTSW 1 170004812 splice site probably benign
fingers UTSW 1 169988540 missense probably benign 0.16
julio UTSW 1 169997929 critical splice donor site probably null
phalanges UTSW 1 170005240 nonsense probably null
revolta UTSW 1 169988520 nonsense probably null
R0574:Ddr2 UTSW 1 169981963 splice site probably benign
R0730:Ddr2 UTSW 1 169995566 missense probably benign
R0733:Ddr2 UTSW 1 170004812 splice site probably benign
R0883:Ddr2 UTSW 1 169994629 missense probably benign 0.01
R1340:Ddr2 UTSW 1 169998084 missense probably benign
R1815:Ddr2 UTSW 1 169995601 nonsense probably null
R1921:Ddr2 UTSW 1 170004245 missense probably damaging 1.00
R1924:Ddr2 UTSW 1 169982072 missense probably benign 0.01
R2016:Ddr2 UTSW 1 169984968 missense probably damaging 1.00
R2079:Ddr2 UTSW 1 170004776 nonsense probably null
R2178:Ddr2 UTSW 1 169994682 missense probably benign 0.18
R2903:Ddr2 UTSW 1 169998161 missense probably damaging 1.00
R3051:Ddr2 UTSW 1 169988455 missense probably benign 0.01
R3971:Ddr2 UTSW 1 169988417 missense probably damaging 1.00
R4290:Ddr2 UTSW 1 169990609 missense probably benign 0.00
R4494:Ddr2 UTSW 1 169988414 missense probably damaging 1.00
R4606:Ddr2 UTSW 1 170001852 missense probably benign 0.05
R4721:Ddr2 UTSW 1 170005240 nonsense probably null
R4855:Ddr2 UTSW 1 169988497 missense possibly damaging 0.94
R4871:Ddr2 UTSW 1 170004771 missense probably benign 0.19
R4923:Ddr2 UTSW 1 169997929 critical splice donor site probably null
R5207:Ddr2 UTSW 1 169984961 missense probably damaging 1.00
R5325:Ddr2 UTSW 1 170001837 missense probably benign 0.00
R5439:Ddr2 UTSW 1 170004729 missense possibly damaging 0.92
R5723:Ddr2 UTSW 1 169988520 nonsense probably null
R5833:Ddr2 UTSW 1 170004696 missense probably benign 0.01
R5924:Ddr2 UTSW 1 169994628 missense probably benign 0.03
R6020:Ddr2 UTSW 1 170005102 missense probably benign 0.15
R6270:Ddr2 UTSW 1 169988540 missense probably benign 0.16
R6326:Ddr2 UTSW 1 169987140 missense probably damaging 1.00
R6328:Ddr2 UTSW 1 169987065 missense possibly damaging 0.52
R6794:Ddr2 UTSW 1 169982098 missense probably damaging 1.00
R6925:Ddr2 UTSW 1 169998132 missense probably benign 0.01
X0004:Ddr2 UTSW 1 169987098 missense probably benign 0.10
X0027:Ddr2 UTSW 1 169982030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGATGCACTTCCTACCTC -3'
(R):5'- ATTGCCACTGTCCAGAAGACTG -3'

Sequencing Primer
(F):5'- ACTCTCTTCCCTGTGGAGC -3'
(R):5'- CCACTGTCCAGAAGACTGAATTATGG -3'
Posted On2015-11-11