Incidental Mutation 'R4734:Abcb11'
ID359132
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission 041961-MU
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4734 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69323962 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 87 (T87S)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102709
AA Change: T87S

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: T87S

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102710
AA Change: T87S

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: T87S

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000180142
AA Change: T87S

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: T87S

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,417 M86K possibly damaging Het
2700062C07Rik A G 18: 24,470,904 M1V probably null Het
Arap3 A G 18: 37,996,275 V210A probably benign Het
Avl9 T C 6: 56,736,494 S246P probably damaging Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Chsy3 C A 18: 59,179,413 F319L probably benign Het
Coro2b T C 9: 62,426,578 T345A probably benign Het
Cpb1 A G 3: 20,263,712 V216A probably benign Het
Cyp2c65 A G 19: 39,072,334 I213V probably benign Het
Dcaf15 A G 8: 84,097,728 C586R probably benign Het
Ddr2 T A 1: 169,998,088 E314D probably benign Het
Dennd5a C T 7: 109,896,336 R1196H probably damaging Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dpf2 A G 19: 5,906,999 probably null Het
Eif2ak4 A T 2: 118,422,087 H302L probably damaging Het
Eif2d G T 1: 131,165,152 R399L probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Fhod3 T A 18: 25,028,135 Y575N probably benign Het
Fscb T C 12: 64,474,470 E74G possibly damaging Het
Gdpd2 G A X: 100,734,193 M243I possibly damaging Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gm281 T C 14: 13,845,292 N540S probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Gnl2 T C 4: 125,041,018 F156L probably benign Het
Gpr37 C A 6: 25,689,086 R4L possibly damaging Het
Hectd4 A T 5: 121,341,977 H2892L possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Impact T A 18: 12,985,289 H188Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnx2 C T 5: 147,029,137 G391R probably damaging Het
Lrrc19 T C 4: 94,638,349 I324V probably benign Het
Lrrcc1 G T 3: 14,562,285 Q458H probably damaging Het
Maml3 A T 3: 51,689,875 D483E probably damaging Het
Mef2c T A 13: 83,662,629 *467R probably null Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Myt1l T C 12: 29,919,926 I143T possibly damaging Het
Nuggc T C 14: 65,623,230 Y426H probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr464 T A 11: 87,914,190 T239S probably damaging Het
Olfr470 T C 7: 107,845,428 I102V probably benign Het
Olfr491 A T 7: 108,317,752 N286I probably damaging Het
Olfr566 A G 7: 102,856,979 I101T probably damaging Het
Oog2 T C 4: 144,196,451 S429P probably benign Het
Pcnt T C 10: 76,437,206 D93G probably benign Het
Pdia5 A T 16: 35,456,513 M95K probably benign Het
Pdzrn4 A T 15: 92,770,252 R762* probably null Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Ppil3 A G 1: 58,431,269 Y141H probably benign Het
Rassf8 G T 6: 145,815,540 K197N probably benign Het
Ryr2 T C 13: 11,737,753 Q1894R probably damaging Het
Ryr3 T A 2: 112,910,502 N487Y probably damaging Het
Scn5a T C 9: 119,539,538 Y307C probably damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Shroom1 C T 11: 53,465,233 S370F probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc2a9 C A 5: 38,382,099 G353C probably damaging Het
Snx33 T A 9: 56,925,901 T295S possibly damaging Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Supt6 T C 11: 78,224,683 D761G probably benign Het
Tfeb T C 17: 47,785,862 V18A probably benign Het
Thap12 G T 7: 98,715,954 C443F probably damaging Het
Thap12 T A 7: 98,715,955 C443* probably null Het
Tmem67 T C 4: 12,063,158 D496G probably benign Het
Trappc8 G A 18: 20,841,572 R900* probably null Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Trmt1l A T 1: 151,442,637 I80L probably benign Het
Trpm5 C A 7: 143,082,785 V472L probably benign Het
Tspear C T 10: 77,864,695 L120F probably damaging Het
Ttc9b G A 7: 27,656,018 V238M probably benign Het
Usp20 A G 2: 31,019,824 I819V probably benign Het
Vmn2r102 T A 17: 19,677,533 V270E probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6593:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTTCCAACTCAGTCGGTATTG -3'
(R):5'- ATTAAATAGCCCTCCTGCCC -3'

Sequencing Primer
(F):5'- CCAACTCAGTCGGTATTGTCTTTGG -3'
(R):5'- GCCCTCCTGCCCATCCC -3'
Posted On2015-11-11