Incidental Mutation 'R0332:Try10'
ID35914
Institutional Source Beutler Lab
Gene Symbol Try10
Ensembl Gene ENSMUSG00000071521
Gene Nametrypsin 10
Synonymstrypsinogen 10
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0332 (G1)
Quality Score178
Status Validated
Chromosome6
Chromosomal Location41354105-41357914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41354220 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 10 (V10E)
Ref Sequence ENSEMBL: ENSMUSP00000071976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072103]
Predicted Effect probably benign
Transcript: ENSMUST00000072103
AA Change: V10E

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071976
Gene: ENSMUSG00000071521
AA Change: V10E

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Tryp_SPc 23 239 3.38e-104 SMART
Meta Mutation Damage Score 0.1064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Mutations in this gene are associated with hereditary pancreatitis. This gene and several other trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Try10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:Try10 APN 6 41356589 missense probably benign 0.00
IGL02608:Try10 APN 6 41355487 missense probably damaging 1.00
IGL03280:Try10 APN 6 41354220 missense probably benign 0.18
R1628:Try10 UTSW 6 41357456 missense probably damaging 1.00
R2149:Try10 UTSW 6 41356561 missense probably benign 0.02
R2471:Try10 UTSW 6 41356746 missense probably damaging 1.00
R3764:Try10 UTSW 6 41356524 missense probably benign 0.07
R4008:Try10 UTSW 6 41356674 missense probably benign 0.00
R4660:Try10 UTSW 6 41357827 missense probably damaging 1.00
R4792:Try10 UTSW 6 41355452 missense probably benign 0.33
R5185:Try10 UTSW 6 41356549 missense probably damaging 0.96
R6103:Try10 UTSW 6 41356550 missense probably damaging 0.98
R6301:Try10 UTSW 6 41355589 missense probably benign 0.30
R6692:Try10 UTSW 6 41357821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGAAAGCTACAGGTGTGCTC -3'
(R):5'- CAGTCTGTTGGACCCATGCAGAAG -3'

Sequencing Primer
(F):5'- GTGCTCCTGTAGTAGCAGAC -3'
(R):5'- ATGCAGAAGACCTGCTGGTTC -3'
Posted On2013-05-09