Incidental Mutation 'R0332:Nlrp2'
ID35916
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene NameNLR family, pyrin domain containing 2
SynonymsNbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R0332 (G1)
Quality Score223
Status Validated
Chromosome7
Chromosomal Location5298547-5351035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5317630 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 836 (C836F)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]
Predicted Effect probably damaging
Transcript: ENSMUST00000045022
AA Change: C836F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: C836F

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207520
Predicted Effect probably benign
Transcript: ENSMUST00000207685
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 unclassified probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTAGATTGCACTCCGTGCAGC -3'
(R):5'- GCACCATGCATACTGGCATTCTTTC -3'

Sequencing Primer
(F):5'- GCAGCTTATGCTTTCACACAGG -3'
(R):5'- TGTTGAACCCTGATAGGCTC -3'
Posted On2013-05-09