Incidental Mutation 'R4734:Slc29a3'
ID359173
Institutional Source Beutler Lab
Gene Symbol Slc29a3
Ensembl Gene ENSMUSG00000020100
Gene Namesolute carrier family 29 (nucleoside transporters), member 3
Synonyms4933435C21Rik, Ent3
MMRRC Submission 041961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4734 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location60712072-60752794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60716326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 313 (V313A)
Ref Sequence ENSEMBL: ENSMUSP00000112685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117513] [ENSMUST00000119595] [ENSMUST00000150845]
Predicted Effect probably benign
Transcript: ENSMUST00000117513
AA Change: V313A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112685
Gene: ENSMUSG00000020100
AA Change: V313A

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
Pfam:Nucleoside_tran 169 473 2.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119595
SMART Domains Protein: ENSMUSP00000112426
Gene: ENSMUSG00000020100

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144989
Predicted Effect probably benign
Transcript: ENSMUST00000150845
SMART Domains Protein: ENSMUSP00000119716
Gene: ENSMUSG00000020100

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 117 125 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoside transporter. The encoded protein plays a role in cellular uptake of nucleosides, nucleobases, and their related analogs. Mutations in this gene have been associated with H syndrome, which is characterized by cutaneous hyperpigmentation and hypertrichosis, hepatosplenomegaly, heart anomalies, and hypogonadism. A related disorder, PHID (pigmented hypertrichosis with insulin-dependent diabetes mellitus), has also been associated with mutations at this locus. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lymphadenopathy, splenomegaly, histiocytic sarcoma, and premature death associated with extramedullary hematopoiesis, increased macrophage proliferation and apoptosis and abnormal lysosome function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,417 M86K possibly damaging Het
2700062C07Rik A G 18: 24,470,904 M1V probably null Het
Abcb11 T A 2: 69,323,962 T87S possibly damaging Het
Arap3 A G 18: 37,996,275 V210A probably benign Het
Avl9 T C 6: 56,736,494 S246P probably damaging Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Chsy3 C A 18: 59,179,413 F319L probably benign Het
Coro2b T C 9: 62,426,578 T345A probably benign Het
Cpb1 A G 3: 20,263,712 V216A probably benign Het
Cyp2c65 A G 19: 39,072,334 I213V probably benign Het
Dcaf15 A G 8: 84,097,728 C586R probably benign Het
Ddr2 T A 1: 169,998,088 E314D probably benign Het
Dennd5a C T 7: 109,896,336 R1196H probably damaging Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dpf2 A G 19: 5,906,999 probably null Het
Eif2ak4 A T 2: 118,422,087 H302L probably damaging Het
Eif2d G T 1: 131,165,152 R399L probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Fhod3 T A 18: 25,028,135 Y575N probably benign Het
Fscb T C 12: 64,474,470 E74G possibly damaging Het
Gdpd2 G A X: 100,734,193 M243I possibly damaging Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gm281 T C 14: 13,845,292 N540S probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Gnl2 T C 4: 125,041,018 F156L probably benign Het
Gpr37 C A 6: 25,689,086 R4L possibly damaging Het
Hectd4 A T 5: 121,341,977 H2892L possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Impact T A 18: 12,985,289 H188Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnx2 C T 5: 147,029,137 G391R probably damaging Het
Lrrc19 T C 4: 94,638,349 I324V probably benign Het
Lrrcc1 G T 3: 14,562,285 Q458H probably damaging Het
Maml3 A T 3: 51,689,875 D483E probably damaging Het
Mef2c T A 13: 83,662,629 *467R probably null Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Myt1l T C 12: 29,919,926 I143T possibly damaging Het
Nuggc T C 14: 65,623,230 Y426H probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr464 T A 11: 87,914,190 T239S probably damaging Het
Olfr470 T C 7: 107,845,428 I102V probably benign Het
Olfr491 A T 7: 108,317,752 N286I probably damaging Het
Olfr566 A G 7: 102,856,979 I101T probably damaging Het
Oog2 T C 4: 144,196,451 S429P probably benign Het
Pcnt T C 10: 76,437,206 D93G probably benign Het
Pdia5 A T 16: 35,456,513 M95K probably benign Het
Pdzrn4 A T 15: 92,770,252 R762* probably null Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Ppil3 A G 1: 58,431,269 Y141H probably benign Het
Rassf8 G T 6: 145,815,540 K197N probably benign Het
Ryr2 T C 13: 11,737,753 Q1894R probably damaging Het
Ryr3 T A 2: 112,910,502 N487Y probably damaging Het
Scn5a T C 9: 119,539,538 Y307C probably damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Shroom1 C T 11: 53,465,233 S370F probably damaging Het
Slc2a9 C A 5: 38,382,099 G353C probably damaging Het
Snx33 T A 9: 56,925,901 T295S possibly damaging Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Supt6 T C 11: 78,224,683 D761G probably benign Het
Tfeb T C 17: 47,785,862 V18A probably benign Het
Thap12 G T 7: 98,715,954 C443F probably damaging Het
Thap12 T A 7: 98,715,955 C443* probably null Het
Tmem67 T C 4: 12,063,158 D496G probably benign Het
Trappc8 G A 18: 20,841,572 R900* probably null Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Trmt1l A T 1: 151,442,637 I80L probably benign Het
Trpm5 C A 7: 143,082,785 V472L probably benign Het
Tspear C T 10: 77,864,695 L120F probably damaging Het
Ttc9b G A 7: 27,656,018 V238M probably benign Het
Usp20 A G 2: 31,019,824 I819V probably benign Het
Vmn2r102 T A 17: 19,677,533 V270E probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Other mutations in Slc29a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Slc29a3 APN 10 60723817 missense possibly damaging 0.95
R1967:Slc29a3 UTSW 10 60716464 missense probably benign
R1986:Slc29a3 UTSW 10 60723814 missense probably damaging 1.00
R2206:Slc29a3 UTSW 10 60715907 missense possibly damaging 0.87
R3891:Slc29a3 UTSW 10 60716261 nonsense probably null
R4748:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R4749:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R5682:Slc29a3 UTSW 10 60716212 missense probably benign 0.00
R5938:Slc29a3 UTSW 10 60752784 unclassified probably benign
R6104:Slc29a3 UTSW 10 60721002 missense possibly damaging 0.77
R6405:Slc29a3 UTSW 10 60716026 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGGCTGGTAGTTACAGAGCAAG -3'
(R):5'- CCCTGCAGGTACTACATGAG -3'

Sequencing Primer
(F):5'- AGCTTGCTCCTAGGACCTG -3'
(R):5'- TACTACATGAGGCCAGTTGC -3'
Posted On2015-11-11