Incidental Mutation 'R4734:Mef2c'
ID359192
Institutional Source Beutler Lab
Gene Symbol Mef2c
Ensembl Gene ENSMUSG00000005583
Gene Namemyocyte enhancer factor 2C
Synonyms9930028G15Rik, 5430401D19Rik
MMRRC Submission 041961-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4734 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location83504034-83667080 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 83662629 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 467 (*467R)
Ref Sequence ENSEMBL: ENSMUSP00000143315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005722] [ENSMUST00000163888] [ENSMUST00000185052] [ENSMUST00000197145] [ENSMUST00000197146] [ENSMUST00000197681] [ENSMUST00000197722] [ENSMUST00000198199] [ENSMUST00000198217] [ENSMUST00000199019] [ENSMUST00000199105] [ENSMUST00000199210] [ENSMUST00000199432] [ENSMUST00000199450]
Predicted Effect probably null
Transcript: ENSMUST00000005722
AA Change: *465R
SMART Domains Protein: ENSMUSP00000005722
Gene: ENSMUSG00000005583
AA Change: *465R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 154 5.3e-27 PFAM
low complexity region 314 324 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163888
AA Change: *485R
SMART Domains Protein: ENSMUSP00000132547
Gene: ENSMUSG00000005583
AA Change: *485R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 155 1.4e-17 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185052
AA Change: *473R
SMART Domains Protein: ENSMUSP00000138826
Gene: ENSMUSG00000005583
AA Change: *473R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 154 6e-27 PFAM
low complexity region 322 332 N/A INTRINSIC
low complexity region 418 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197145
SMART Domains Protein: ENSMUSP00000142619
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197146
AA Change: *443R
SMART Domains Protein: ENSMUSP00000143227
Gene: ENSMUSG00000005583
AA Change: *443R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 9.5e-15 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197681
AA Change: *443R
SMART Domains Protein: ENSMUSP00000143420
Gene: ENSMUSG00000005583
AA Change: *443R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 9.5e-15 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197722
SMART Domains Protein: ENSMUSP00000142456
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 2.8e-12 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198199
AA Change: *433R
SMART Domains Protein: ENSMUSP00000143742
Gene: ENSMUSG00000005583
AA Change: *433R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 153 2e-23 PFAM
low complexity region 314 324 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198217
AA Change: *419R
SMART Domains Protein: ENSMUSP00000142487
Gene: ENSMUSG00000005583
AA Change: *419R

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 364 380 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199019
AA Change: *475R
SMART Domains Protein: ENSMUSP00000143401
Gene: ENSMUSG00000005583
AA Change: *475R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 1.1e-14 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199105
AA Change: *475R
SMART Domains Protein: ENSMUSP00000143212
Gene: ENSMUSG00000005583
AA Change: *475R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 1.1e-14 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199210
AA Change: *395R
SMART Domains Protein: ENSMUSP00000142595
Gene: ENSMUSG00000005583
AA Change: *395R

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
low complexity region 276 286 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199432
AA Change: *435R
SMART Domains Protein: ENSMUSP00000142714
Gene: ENSMUSG00000005583
AA Change: *435R

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 3.1e-12 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199450
AA Change: *467R
SMART Domains Protein: ENSMUSP00000143315
Gene: ENSMUSG00000005583
AA Change: *467R

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 5.1e-15 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200138
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the MADS box transcription enhancer factor 2 (MEF2) family of proteins, which play a role in myogenesis. The encoded protein, MEF2 polypeptide C, has both trans-activating and DNA binding activities. This protein may play a role in maintaining the differentiated state of muscle cells. Mutations and deletions at this locus have been associated with severe mental retardation, stereotypic movements, epilepsy, and cerebral malformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have cardiovascular abnormalities and die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,417 M86K possibly damaging Het
2700062C07Rik A G 18: 24,470,904 M1V probably null Het
Abcb11 T A 2: 69,323,962 T87S possibly damaging Het
Arap3 A G 18: 37,996,275 V210A probably benign Het
Avl9 T C 6: 56,736,494 S246P probably damaging Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Chsy3 C A 18: 59,179,413 F319L probably benign Het
Coro2b T C 9: 62,426,578 T345A probably benign Het
Cpb1 A G 3: 20,263,712 V216A probably benign Het
Cyp2c65 A G 19: 39,072,334 I213V probably benign Het
Dcaf15 A G 8: 84,097,728 C586R probably benign Het
Ddr2 T A 1: 169,998,088 E314D probably benign Het
Dennd5a C T 7: 109,896,336 R1196H probably damaging Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dpf2 A G 19: 5,906,999 probably null Het
Eif2ak4 A T 2: 118,422,087 H302L probably damaging Het
Eif2d G T 1: 131,165,152 R399L probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Fhod3 T A 18: 25,028,135 Y575N probably benign Het
Fscb T C 12: 64,474,470 E74G possibly damaging Het
Gdpd2 G A X: 100,734,193 M243I possibly damaging Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gm281 T C 14: 13,845,292 N540S probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Gnl2 T C 4: 125,041,018 F156L probably benign Het
Gpr37 C A 6: 25,689,086 R4L possibly damaging Het
Hectd4 A T 5: 121,341,977 H2892L possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Impact T A 18: 12,985,289 H188Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnx2 C T 5: 147,029,137 G391R probably damaging Het
Lrrc19 T C 4: 94,638,349 I324V probably benign Het
Lrrcc1 G T 3: 14,562,285 Q458H probably damaging Het
Maml3 A T 3: 51,689,875 D483E probably damaging Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Myt1l T C 12: 29,919,926 I143T possibly damaging Het
Nuggc T C 14: 65,623,230 Y426H probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr464 T A 11: 87,914,190 T239S probably damaging Het
Olfr470 T C 7: 107,845,428 I102V probably benign Het
Olfr491 A T 7: 108,317,752 N286I probably damaging Het
Olfr566 A G 7: 102,856,979 I101T probably damaging Het
Oog2 T C 4: 144,196,451 S429P probably benign Het
Pcnt T C 10: 76,437,206 D93G probably benign Het
Pdia5 A T 16: 35,456,513 M95K probably benign Het
Pdzrn4 A T 15: 92,770,252 R762* probably null Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Ppil3 A G 1: 58,431,269 Y141H probably benign Het
Rassf8 G T 6: 145,815,540 K197N probably benign Het
Ryr2 T C 13: 11,737,753 Q1894R probably damaging Het
Ryr3 T A 2: 112,910,502 N487Y probably damaging Het
Scn5a T C 9: 119,539,538 Y307C probably damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Shroom1 C T 11: 53,465,233 S370F probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc2a9 C A 5: 38,382,099 G353C probably damaging Het
Snx33 T A 9: 56,925,901 T295S possibly damaging Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Supt6 T C 11: 78,224,683 D761G probably benign Het
Tfeb T C 17: 47,785,862 V18A probably benign Het
Thap12 G T 7: 98,715,954 C443F probably damaging Het
Thap12 T A 7: 98,715,955 C443* probably null Het
Tmem67 T C 4: 12,063,158 D496G probably benign Het
Trappc8 G A 18: 20,841,572 R900* probably null Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Trmt1l A T 1: 151,442,637 I80L probably benign Het
Trpm5 C A 7: 143,082,785 V472L probably benign Het
Tspear C T 10: 77,864,695 L120F probably damaging Het
Ttc9b G A 7: 27,656,018 V238M probably benign Het
Usp20 A G 2: 31,019,824 I819V probably benign Het
Vmn2r102 T A 17: 19,677,533 V270E probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Other mutations in Mef2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Mef2c APN 13 83625380 missense probably damaging 1.00
IGL01012:Mef2c APN 13 83655595 missense probably damaging 1.00
IGL03131:Mef2c APN 13 83662375 missense probably damaging 1.00
IGL03186:Mef2c APN 13 83652868 missense probably benign 0.03
LCD18:Mef2c UTSW 13 83605823 intron probably benign
R0021:Mef2c UTSW 13 83656240 missense probably damaging 1.00
R0062:Mef2c UTSW 13 83652873 missense possibly damaging 0.65
R0480:Mef2c UTSW 13 83592901 missense probably damaging 1.00
R0755:Mef2c UTSW 13 83656353 critical splice donor site probably null
R1290:Mef2c UTSW 13 83662359 missense probably benign 0.19
R4085:Mef2c UTSW 13 83575702 missense probably damaging 0.98
R5230:Mef2c UTSW 13 83652907 missense possibly damaging 0.89
R5385:Mef2c UTSW 13 83662413 missense probably benign 0.19
R6032:Mef2c UTSW 13 83662359 missense probably benign 0.19
R6032:Mef2c UTSW 13 83662359 missense probably benign 0.19
R6258:Mef2c UTSW 13 83652938 missense probably damaging 1.00
R6670:Mef2c UTSW 13 83662597 missense probably damaging 1.00
R6672:Mef2c UTSW 13 83652856 missense probably damaging 1.00
R6702:Mef2c UTSW 13 83625406 missense possibly damaging 0.70
R6703:Mef2c UTSW 13 83625406 missense possibly damaging 0.70
R6881:Mef2c UTSW 13 83592942 missense probably damaging 1.00
R6907:Mef2c UTSW 13 83654611 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GGTCTCCTGTTGACAGCTTG -3'
(R):5'- CAAGTGTTCTGTTGTACAACTCAAG -3'

Sequencing Primer
(F):5'- TGAGCAGCTGTAGCAGTTCCTAC -3'
(R):5'- TAATGCATATCGACCCCC -3'
Posted On2015-11-11