Incidental Mutation 'R4734:Mms19'
ID359208
Institutional Source Beutler Lab
Gene Symbol Mms19
Ensembl Gene ENSMUSG00000025159
Gene NameMMS19 (MET18 S. cerevisiae)
SynonymsMms19, 2610042O15Rik, C86341, Mms19l
MMRRC Submission 041961-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4734 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41941086-41981157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41944558 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1031 (S1031C)
Ref Sequence ENSEMBL: ENSMUSP00000130900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026154] [ENSMUST00000026168] [ENSMUST00000163287] [ENSMUST00000163398] [ENSMUST00000164776] [ENSMUST00000167820] [ENSMUST00000167927] [ENSMUST00000169775] [ENSMUST00000171561] [ENSMUST00000223802] [ENSMUST00000224562] [ENSMUST00000225968]
Predicted Effect probably benign
Transcript: ENSMUST00000026154
SMART Domains Protein: ENSMUSP00000026154
Gene: ENSMUSG00000025157

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 115 137 N/A INTRINSIC
Pfam:zf-DHHC 151 289 1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026168
AA Change: S988C

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026168
Gene: ENSMUSG00000025159
AA Change: S988C

DomainStartEndE-ValueType
Pfam:MMS19_N 51 167 1.4e-29 PFAM
Pfam:MMS19_N 163 270 2.4e-44 PFAM
low complexity region 329 343 N/A INTRINSIC
Pfam:MMS19_C 484 921 4.3e-120 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163287
AA Change: S885C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128653
Gene: ENSMUSG00000025159
AA Change: S885C

DomainStartEndE-ValueType
Pfam:MMS19_N 3 265 9.8e-97 PFAM
Pfam:MMS19_C 381 818 1e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163398
Predicted Effect probably benign
Transcript: ENSMUST00000164776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165043
Predicted Effect probably benign
Transcript: ENSMUST00000166090
SMART Domains Protein: ENSMUSP00000131219
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_C 102 494 2.2e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167820
SMART Domains Protein: ENSMUSP00000130399
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_C 63 286 7.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167927
SMART Domains Protein: ENSMUSP00000132483
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169775
SMART Domains Protein: ENSMUSP00000128234
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 167 1.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170209
Predicted Effect probably damaging
Transcript: ENSMUST00000171561
AA Change: S1031C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130900
Gene: ENSMUSG00000025159
AA Change: S1031C

DomainStartEndE-ValueType
Pfam:MMS19_N 51 312 6.3e-90 PFAM
low complexity region 372 386 N/A INTRINSIC
Pfam:MMS19_C 528 963 3.9e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223785
Predicted Effect probably benign
Transcript: ENSMUST00000223802
Predicted Effect probably benign
Transcript: ENSMUST00000224537
Predicted Effect probably benign
Transcript: ENSMUST00000224562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225433
Predicted Effect probably benign
Transcript: ENSMUST00000225968
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,417 M86K possibly damaging Het
2700062C07Rik A G 18: 24,470,904 M1V probably null Het
Abcb11 T A 2: 69,323,962 T87S possibly damaging Het
Arap3 A G 18: 37,996,275 V210A probably benign Het
Avl9 T C 6: 56,736,494 S246P probably damaging Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Chsy3 C A 18: 59,179,413 F319L probably benign Het
Coro2b T C 9: 62,426,578 T345A probably benign Het
Cpb1 A G 3: 20,263,712 V216A probably benign Het
Cyp2c65 A G 19: 39,072,334 I213V probably benign Het
Dcaf15 A G 8: 84,097,728 C586R probably benign Het
Ddr2 T A 1: 169,998,088 E314D probably benign Het
Dennd5a C T 7: 109,896,336 R1196H probably damaging Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dpf2 A G 19: 5,906,999 probably null Het
Eif2ak4 A T 2: 118,422,087 H302L probably damaging Het
Eif2d G T 1: 131,165,152 R399L probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Fhod3 T A 18: 25,028,135 Y575N probably benign Het
Fscb T C 12: 64,474,470 E74G possibly damaging Het
Gdpd2 G A X: 100,734,193 M243I possibly damaging Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gm281 T C 14: 13,845,292 N540S probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Gnl2 T C 4: 125,041,018 F156L probably benign Het
Gpr37 C A 6: 25,689,086 R4L possibly damaging Het
Hectd4 A T 5: 121,341,977 H2892L possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Impact T A 18: 12,985,289 H188Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnx2 C T 5: 147,029,137 G391R probably damaging Het
Lrrc19 T C 4: 94,638,349 I324V probably benign Het
Lrrcc1 G T 3: 14,562,285 Q458H probably damaging Het
Maml3 A T 3: 51,689,875 D483E probably damaging Het
Mef2c T A 13: 83,662,629 *467R probably null Het
Myt1l T C 12: 29,919,926 I143T possibly damaging Het
Nuggc T C 14: 65,623,230 Y426H probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr464 T A 11: 87,914,190 T239S probably damaging Het
Olfr470 T C 7: 107,845,428 I102V probably benign Het
Olfr491 A T 7: 108,317,752 N286I probably damaging Het
Olfr566 A G 7: 102,856,979 I101T probably damaging Het
Oog2 T C 4: 144,196,451 S429P probably benign Het
Pcnt T C 10: 76,437,206 D93G probably benign Het
Pdia5 A T 16: 35,456,513 M95K probably benign Het
Pdzrn4 A T 15: 92,770,252 R762* probably null Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Ppil3 A G 1: 58,431,269 Y141H probably benign Het
Rassf8 G T 6: 145,815,540 K197N probably benign Het
Ryr2 T C 13: 11,737,753 Q1894R probably damaging Het
Ryr3 T A 2: 112,910,502 N487Y probably damaging Het
Scn5a T C 9: 119,539,538 Y307C probably damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Shroom1 C T 11: 53,465,233 S370F probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc2a9 C A 5: 38,382,099 G353C probably damaging Het
Snx33 T A 9: 56,925,901 T295S possibly damaging Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Supt6 T C 11: 78,224,683 D761G probably benign Het
Tfeb T C 17: 47,785,862 V18A probably benign Het
Thap12 G T 7: 98,715,954 C443F probably damaging Het
Thap12 T A 7: 98,715,955 C443* probably null Het
Tmem67 T C 4: 12,063,158 D496G probably benign Het
Trappc8 G A 18: 20,841,572 R900* probably null Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Trmt1l A T 1: 151,442,637 I80L probably benign Het
Trpm5 C A 7: 143,082,785 V472L probably benign Het
Tspear C T 10: 77,864,695 L120F probably damaging Het
Ttc9b G A 7: 27,656,018 V238M probably benign Het
Usp20 A G 2: 31,019,824 I819V probably benign Het
Vmn2r102 T A 17: 19,677,533 V270E probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Other mutations in Mms19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Mms19 APN 19 41948233 missense probably benign 0.12
IGL00157:Mms19 APN 19 41945457 critical splice donor site probably null
IGL01997:Mms19 APN 19 41956531 missense probably damaging 1.00
IGL02081:Mms19 APN 19 41949979 critical splice donor site probably null
IGL02171:Mms19 APN 19 41957139 critical splice donor site probably null
IGL02306:Mms19 APN 19 41966264 missense probably damaging 1.00
IGL02678:Mms19 APN 19 41954476 missense possibly damaging 0.84
IGL02795:Mms19 APN 19 41952406 critical splice donor site probably null
IGL03233:Mms19 APN 19 41946913 splice site probably null
IGL03250:Mms19 APN 19 41954464 critical splice donor site probably null
R0049:Mms19 UTSW 19 41955168 missense probably damaging 0.99
R0049:Mms19 UTSW 19 41955168 missense probably damaging 0.99
R0480:Mms19 UTSW 19 41954846 missense probably damaging 0.98
R0498:Mms19 UTSW 19 41949773 missense possibly damaging 0.82
R0505:Mms19 UTSW 19 41953734 missense probably damaging 1.00
R0547:Mms19 UTSW 19 41963418 missense probably damaging 0.99
R1102:Mms19 UTSW 19 41950845 missense possibly damaging 0.77
R1183:Mms19 UTSW 19 41954831 missense possibly damaging 0.83
R1544:Mms19 UTSW 19 41955821 critical splice donor site probably null
R1666:Mms19 UTSW 19 41952556 missense possibly damaging 0.73
R1668:Mms19 UTSW 19 41952556 missense possibly damaging 0.73
R1808:Mms19 UTSW 19 41966259 missense probably damaging 1.00
R1827:Mms19 UTSW 19 41953677 missense probably benign 0.00
R3055:Mms19 UTSW 19 41950088 splice site probably benign
R3551:Mms19 UTSW 19 41949798 missense probably benign 0.04
R3716:Mms19 UTSW 19 41944735 missense probably damaging 1.00
R3877:Mms19 UTSW 19 41966256 nonsense probably null
R4288:Mms19 UTSW 19 41945553 missense probably damaging 1.00
R4289:Mms19 UTSW 19 41945553 missense probably damaging 1.00
R4445:Mms19 UTSW 19 41963933 missense possibly damaging 0.48
R4446:Mms19 UTSW 19 41963933 missense possibly damaging 0.48
R4610:Mms19 UTSW 19 41945496 missense possibly damaging 0.91
R4748:Mms19 UTSW 19 41944558 missense probably damaging 1.00
R5315:Mms19 UTSW 19 41954762 missense possibly damaging 0.68
R5492:Mms19 UTSW 19 41955831 missense possibly damaging 0.91
R5621:Mms19 UTSW 19 41966313 missense probably benign 0.27
R5643:Mms19 UTSW 19 41955866 missense possibly damaging 0.87
R5769:Mms19 UTSW 19 41964386 missense probably damaging 1.00
R6567:Mms19 UTSW 19 41949767 critical splice donor site probably null
R6569:Mms19 UTSW 19 41964368 missense possibly damaging 0.93
R6588:Mms19 UTSW 19 41966276 missense probably damaging 1.00
R6645:Mms19 UTSW 19 41955191 missense probably benign 0.04
R6696:Mms19 UTSW 19 41954013 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCCTATTCCTGACAGACACGG -3'
(R):5'- TCATCCGAGCCTTAGCCAAG -3'

Sequencing Primer
(F):5'- CTATTCCTGACAGACACGGGAGAG -3'
(R):5'- TTAGCCAAGCCTCTGGACGAC -3'
Posted On2015-11-11