Incidental Mutation 'R0332:Olfr555'
ID35921
Institutional Source Beutler Lab
Gene Symbol Olfr555
Ensembl Gene ENSMUSG00000073970
Gene Nameolfactory receptor 555
SynonymsMOR10-1, GA_x6K02T2PBJ9-5375442-5376389
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R0332 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102658823-102659770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102659465 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 215 (I215F)
Ref Sequence ENSEMBL: ENSMUSP00000095823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098220]
Predicted Effect probably damaging
Transcript: ENSMUST00000098220
AA Change: I215F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095823
Gene: ENSMUSG00000073970
AA Change: I215F

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-126 PFAM
Pfam:7TM_GPCR_Srsx 36 308 1.7e-7 PFAM
Pfam:7tm_1 42 293 1.2e-19 PFAM
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Olfr555
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr555 APN 7 102659348 missense probably damaging 0.98
IGL01150:Olfr555 APN 7 102659492 missense probably benign 0.00
IGL02610:Olfr555 APN 7 102659567 missense probably benign 0.41
IGL02679:Olfr555 APN 7 102659177 missense possibly damaging 0.55
R1493:Olfr555 UTSW 7 102659013 missense probably damaging 1.00
R1631:Olfr555 UTSW 7 102659201 missense probably damaging 1.00
R1682:Olfr555 UTSW 7 102659697 missense probably damaging 0.96
R3026:Olfr555 UTSW 7 102659129 missense possibly damaging 0.90
R3103:Olfr555 UTSW 7 102659481 missense probably benign 0.00
R4592:Olfr555 UTSW 7 102659478 missense probably damaging 0.99
R4782:Olfr555 UTSW 7 102658834 missense possibly damaging 0.63
R6282:Olfr555 UTSW 7 102659647 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCCCTTTCTTATAAAACGGCTGC -3'
(R):5'- CCCGGAACACTTGGATGATCCTTC -3'

Sequencing Primer
(F):5'- ATAAAACGGCTGCCCTTCTG -3'
(R):5'- GTCTTCACACTGTAGACAATAGGG -3'
Posted On2013-05-09