Incidental Mutation 'R4734:Htr2c'
ID359210
Institutional Source Beutler Lab
Gene Symbol Htr2c
Ensembl Gene ENSMUSG00000041380
Gene Name5-hydroxytryptamine (serotonin) receptor 2C
Synonyms5-HT2C receptor, SR1, 5HT1c, Htr1c, 5-HT2cR
MMRRC Submission 041961-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4734 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location146962513-147197277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147193797 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 163 (T163A)
Ref Sequence ENSEMBL: ENSMUSP00000138772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036303] [ENSMUST00000096299] [ENSMUST00000156697]
Predicted Effect silent
Transcript: ENSMUST00000036303
SMART Domains Protein: ENSMUSP00000043936
Gene: ENSMUSG00000041380

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 62 273 4.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 65 384 2.8e-17 PFAM
Pfam:7tm_1 71 369 2.2e-71 PFAM
Predicted Effect silent
Transcript: ENSMUST00000096299
SMART Domains Protein: ENSMUSP00000094021
Gene: ENSMUSG00000041380

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:7tm_4 59 242 9.4e-9 PFAM
Pfam:7TM_GPCR_Srx 62 273 2.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 65 384 2.8e-17 PFAM
Pfam:7tm_1 71 369 1.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156697
AA Change: T163A

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138772
Gene: ENSMUSG00000041380
AA Change: T163A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 64 164 2.3e-6 PFAM
Pfam:7tm_1 71 156 3.6e-28 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Serotonin (5-hydroxytryptamine, 5-HT), a neurotransmitter, elicits a wide array of physiological effects by binding to several receptor subtypes, including the 5-HT2 family of seven-transmembrane-spanning, G-protein-coupled receptors, which activate phospholipase C and D signaling pathways. This gene encodes the 2C subtype of serotonin receptor and its mRNA is subject to multiple RNA editing events, where genomically encoded adenosine residues are converted to inosines. RNA editing is predicted to alter amino acids within the second intracellular loop of the 5-HT2C receptor and generate receptor isoforms that differ in their ability to interact with G proteins and the activation of phospholipase C and D signaling cascades, thus modulating serotonergic neurotransmission in the central nervous system. Studies in rodents show altered patterns of RNA editing in response to drug treatments and stressful situations. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hyperactivity, hyperphagia, reduced energy cost of locomotion, late-onset obesity, insulin resistance, and altered responses to cocaine. Mutants are also subject to spontaneous death from seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,417 M86K possibly damaging Het
2700062C07Rik A G 18: 24,470,904 M1V probably null Het
Abcb11 T A 2: 69,323,962 T87S possibly damaging Het
Arap3 A G 18: 37,996,275 V210A probably benign Het
Avl9 T C 6: 56,736,494 S246P probably damaging Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Chsy3 C A 18: 59,179,413 F319L probably benign Het
Coro2b T C 9: 62,426,578 T345A probably benign Het
Cpb1 A G 3: 20,263,712 V216A probably benign Het
Cyp2c65 A G 19: 39,072,334 I213V probably benign Het
Dcaf15 A G 8: 84,097,728 C586R probably benign Het
Ddr2 T A 1: 169,998,088 E314D probably benign Het
Dennd5a C T 7: 109,896,336 R1196H probably damaging Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dpf2 A G 19: 5,906,999 probably null Het
Eif2ak4 A T 2: 118,422,087 H302L probably damaging Het
Eif2d G T 1: 131,165,152 R399L probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Fhod3 T A 18: 25,028,135 Y575N probably benign Het
Fscb T C 12: 64,474,470 E74G possibly damaging Het
Gdpd2 G A X: 100,734,193 M243I possibly damaging Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gm281 T C 14: 13,845,292 N540S probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Gnl2 T C 4: 125,041,018 F156L probably benign Het
Gpr37 C A 6: 25,689,086 R4L possibly damaging Het
Hectd4 A T 5: 121,341,977 H2892L possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Impact T A 18: 12,985,289 H188Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnx2 C T 5: 147,029,137 G391R probably damaging Het
Lrrc19 T C 4: 94,638,349 I324V probably benign Het
Lrrcc1 G T 3: 14,562,285 Q458H probably damaging Het
Maml3 A T 3: 51,689,875 D483E probably damaging Het
Mef2c T A 13: 83,662,629 *467R probably null Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Myt1l T C 12: 29,919,926 I143T possibly damaging Het
Nuggc T C 14: 65,623,230 Y426H probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr464 T A 11: 87,914,190 T239S probably damaging Het
Olfr470 T C 7: 107,845,428 I102V probably benign Het
Olfr491 A T 7: 108,317,752 N286I probably damaging Het
Olfr566 A G 7: 102,856,979 I101T probably damaging Het
Oog2 T C 4: 144,196,451 S429P probably benign Het
Pcnt T C 10: 76,437,206 D93G probably benign Het
Pdia5 A T 16: 35,456,513 M95K probably benign Het
Pdzrn4 A T 15: 92,770,252 R762* probably null Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Ppil3 A G 1: 58,431,269 Y141H probably benign Het
Rassf8 G T 6: 145,815,540 K197N probably benign Het
Ryr2 T C 13: 11,737,753 Q1894R probably damaging Het
Ryr3 T A 2: 112,910,502 N487Y probably damaging Het
Scn5a T C 9: 119,539,538 Y307C probably damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Shroom1 C T 11: 53,465,233 S370F probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc2a9 C A 5: 38,382,099 G353C probably damaging Het
Snx33 T A 9: 56,925,901 T295S possibly damaging Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Supt6 T C 11: 78,224,683 D761G probably benign Het
Tfeb T C 17: 47,785,862 V18A probably benign Het
Thap12 G T 7: 98,715,954 C443F probably damaging Het
Thap12 T A 7: 98,715,955 C443* probably null Het
Tmem67 T C 4: 12,063,158 D496G probably benign Het
Trappc8 G A 18: 20,841,572 R900* probably null Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Trmt1l A T 1: 151,442,637 I80L probably benign Het
Trpm5 C A 7: 143,082,785 V472L probably benign Het
Tspear C T 10: 77,864,695 L120F probably damaging Het
Ttc9b G A 7: 27,656,018 V238M probably benign Het
Usp20 A G 2: 31,019,824 I819V probably benign Het
Vmn2r102 T A 17: 19,677,533 V270E probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Other mutations in Htr2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:Htr2c APN X 147075925 missense probably damaging 1.00
IGL02378:Htr2c APN X 147193759 splice site probably benign
IGL02609:Htr2c APN X 147193760 splice site probably benign
R2228:Htr2c UTSW X 147194190 missense probably damaging 1.00
R2228:Htr2c UTSW X 147194192 missense probably damaging 1.00
R4749:Htr2c UTSW X 147193797 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCACCAATACTTTCCAGGAGC -3'
(R):5'- CAGCACTTTAGAAAGTTCAGGCTG -3'

Sequencing Primer
(F):5'- ATACTTTCCAGGAGCTTCCAGAG -3'
(R):5'- TCGGTGTGACCTCGAAGTAACATC -3'
Posted On2015-11-11