Incidental Mutation 'R0332:Arhgef7'
ID35924
Institutional Source Beutler Lab
Gene Symbol Arhgef7
Ensembl Gene ENSMUSG00000031511
Gene NameRho guanine nucleotide exchange factor (GEF7)
Synonymscool-1, betaPix, Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-b, betaPix-c
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R0332 (G1)
Quality Score203
Status Validated
Chromosome8
Chromosomal Location11727721-11835219 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 11824701 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 777 (Y777*)
Ref Sequence ENSEMBL: ENSMUSP00000106534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074856] [ENSMUST00000098938] [ENSMUST00000110904] [ENSMUST00000110909]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000033908
SMART Domains Protein: ENSMUSP00000033908
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
CH 3 107 7.28e-13 SMART
SH3 166 221 9.97e-26 SMART
RhoGEF 254 429 8.36e-43 SMART
PH 459 559 3.77e-9 SMART
low complexity region 600 614 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 660 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074856
SMART Domains Protein: ENSMUSP00000074399
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 443 457 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
PDB:3L4F|C 587 646 2e-32 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000098938
SMART Domains Protein: ENSMUSP00000096538
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 443 457 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
low complexity region 569 600 N/A INTRINSIC
PDB:3L4F|C 646 705 2e-32 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110904
SMART Domains Protein: ENSMUSP00000106529
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 428 440 N/A INTRINSIC
low complexity region 494 525 N/A INTRINSIC
PDB:3L4F|C 571 630 2e-32 PDB
Predicted Effect probably null
Transcript: ENSMUST00000110909
AA Change: Y777*
SMART Domains Protein: ENSMUSP00000106534
Gene: ENSMUSG00000031511
AA Change: Y777*

DomainStartEndE-ValueType
CH 3 107 7.28e-13 SMART
Pfam:RhoGEF67_u1 117 163 8e-21 PFAM
SH3 166 221 9.97e-26 SMART
RhoGEF 254 429 8.36e-43 SMART
PH 459 559 3.77e-9 SMART
Pfam:RhoGEF67_u2 611 711 2.3e-53 PFAM
low complexity region 726 757 N/A INTRINSIC
Meta Mutation Damage Score 0.674 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of cytoplasmic proteins that activate the Ras-like family of Rho proteins by exchanging bound GDP for GTP. It forms a complex with the small GTP binding protein Rac1 and recruits Rac1 to membrane ruffles and to focal adhesions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Arhgef7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgef7 APN 8 11782540 missense probably damaging 1.00
IGL01481:Arhgef7 APN 8 11815256 missense probably benign 0.01
IGL02376:Arhgef7 APN 8 11817735 missense probably damaging 1.00
IGL02812:Arhgef7 APN 8 11781245 unclassified probably benign
IGL02813:Arhgef7 APN 8 11800767 unclassified probably benign
IGL02864:Arhgef7 APN 8 11815247 missense possibly damaging 0.49
Mental_fitness UTSW 8 11800811 missense probably damaging 1.00
R0139:Arhgef7 UTSW 8 11800503 missense probably damaging 0.99
R0157:Arhgef7 UTSW 8 11785812 missense probably damaging 1.00
R0448:Arhgef7 UTSW 8 11819659 missense possibly damaging 0.78
R0973:Arhgef7 UTSW 8 11819659 missense possibly damaging 0.78
R1491:Arhgef7 UTSW 8 11819733 critical splice donor site probably null
R1566:Arhgef7 UTSW 8 11782620 missense possibly damaging 0.85
R1601:Arhgef7 UTSW 8 11782638 unclassified probably null
R1716:Arhgef7 UTSW 8 11808713 splice site probably null
R1717:Arhgef7 UTSW 8 11808712 unclassified probably benign
R1717:Arhgef7 UTSW 8 11808713 splice site probably null
R1719:Arhgef7 UTSW 8 11808713 splice site probably null
R1901:Arhgef7 UTSW 8 11808713 splice site probably null
R1902:Arhgef7 UTSW 8 11808713 splice site probably null
R1933:Arhgef7 UTSW 8 11808713 splice site probably null
R1934:Arhgef7 UTSW 8 11808713 splice site probably null
R1956:Arhgef7 UTSW 8 11805266 missense probably damaging 1.00
R2122:Arhgef7 UTSW 8 11728256 missense possibly damaging 0.94
R2273:Arhgef7 UTSW 8 11815010 missense possibly damaging 0.94
R2275:Arhgef7 UTSW 8 11815010 missense possibly damaging 0.94
R2306:Arhgef7 UTSW 8 11812680 nonsense probably null
R2375:Arhgef7 UTSW 8 11814995 missense probably benign 0.08
R4530:Arhgef7 UTSW 8 11800802 missense possibly damaging 0.60
R4805:Arhgef7 UTSW 8 11831552 missense probably damaging 1.00
R5204:Arhgef7 UTSW 8 11800775 nonsense probably null
R5212:Arhgef7 UTSW 8 11728388 missense probably benign 0.40
R5256:Arhgef7 UTSW 8 11800811 missense probably damaging 1.00
R5718:Arhgef7 UTSW 8 11785774 missense probably damaging 1.00
R6195:Arhgef7 UTSW 8 11822017 missense probably damaging 1.00
R6503:Arhgef7 UTSW 8 11833054 missense possibly damaging 0.58
R6679:Arhgef7 UTSW 8 11824667 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCTTAGCATGGCAAGGCACTGAC -3'
(R):5'- AAGCCCATCAGGTACTCACTGGAC -3'

Sequencing Primer
(F):5'- GACCTGATGCATAATCACGTCTTG -3'
(R):5'- GGTACTCACTGGACTTGCCAC -3'
Posted On2013-05-09