Incidental Mutation 'R0332:Gm10644'
ID35926
Institutional Source Beutler Lab
Gene Symbol Gm10644
Ensembl Gene ENSMUSG00000074219
Gene Namepredicted gene 10644
Synonyms
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0332 (G1)
Quality Score176
Status Validated
Chromosome8
Chromosomal Location83932329-83955205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83933581 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 45 (L45S)
Ref Sequence ENSEMBL: ENSMUSP00000096195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045393] [ENSMUST00000098595] [ENSMUST00000124355] [ENSMUST00000131717] [ENSMUST00000132500] [ENSMUST00000141158] [ENSMUST00000152978]
Predicted Effect probably benign
Transcript: ENSMUST00000045393
AA Change: K773E

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048422
Gene: ENSMUSG00000013033
AA Change: K773E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 6.6e-23 PFAM
OLF 142 398 8.5e-138 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 1.4e-23 SMART
low complexity region 579 591 N/A INTRINSIC
low complexity region 747 758 N/A INTRINSIC
GPS 797 849 3.5e-27 SMART
Pfam:7tm_2 856 1092 5.3e-66 PFAM
Pfam:Latrophilin 1112 1470 1.7e-177 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098595
AA Change: L45S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096195
Gene: ENSMUSG00000074219
AA Change: L45S

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124355
SMART Domains Protein: ENSMUSP00000116064
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131018
SMART Domains Protein: ENSMUSP00000117720
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
Pfam:Latrophilin 1 213 9.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131717
AA Change: K597E

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118579
Gene: ENSMUSG00000013033
AA Change: K597E

DomainStartEndE-ValueType
OLF 1 222 4.51e-103 SMART
low complexity region 229 265 N/A INTRINSIC
low complexity region 279 294 N/A INTRINSIC
HormR 300 365 2.26e-21 SMART
low complexity region 403 415 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
GPS 621 673 5.64e-25 SMART
Pfam:7tm_2 680 916 7.9e-68 PFAM
Pfam:Latrophilin 936 1295 2.7e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132500
AA Change: K768E

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119100
Gene: ENSMUSG00000013033
AA Change: K768E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.6e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 3.4e-68 PFAM
Pfam:Latrophilin 1146 1511 6.4e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139575
Predicted Effect possibly damaging
Transcript: ENSMUST00000141158
AA Change: K768E

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118452
Gene: ENSMUSG00000013033
AA Change: K768E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 3.4e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 4.5e-68 PFAM
Pfam:Latrophilin 1107 1466 1.1e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150674
Predicted Effect possibly damaging
Transcript: ENSMUST00000152978
AA Change: K773E

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115295
Gene: ENSMUSG00000013033
AA Change: K773E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 2.1e-25 PFAM
OLF 142 398 1.39e-135 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 2.26e-21 SMART
Pfam:GAIN 544 773 4.1e-59 PFAM
GPS 797 849 5.64e-25 SMART
Pfam:7tm_2 856 1092 2.3e-69 PFAM
Pfam:Latrophilin 1112 1516 7.3e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200106
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype Mice homozygous for a targeted null allele at this locus are viable and fertile. Female homozygotes fail adequately to care for their litters.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Gm10644
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1914:Gm10644 UTSW 8 83933850 intron probably benign
R1915:Gm10644 UTSW 8 83933850 intron probably benign
R2184:Gm10644 UTSW 8 83933627 missense possibly damaging 0.66
R5002:Gm10644 UTSW 8 83933587 missense possibly damaging 0.90
R5848:Gm10644 UTSW 8 83934039 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGCATGTGACAGCCCAGTTTCAG -3'
(R):5'- GTGACCACCAGCTTTATGGTCCAAG -3'

Sequencing Primer
(F):5'- GACAGCCCAGTTTCAGTGTATC -3'
(R):5'- TATGGTCCAAGCTGAAGCTC -3'
Posted On2013-05-09