Incidental Mutation 'R4736:Trpc6'
ID359260
Institutional Source Beutler Lab
Gene Symbol Trpc6
Ensembl Gene ENSMUSG00000031997
Gene Nametransient receptor potential cation channel, subfamily C, member 6
Synonymsmtrp6, Trrp6
MMRRC Submission 041963-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4736 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location8544142-8680741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8609870 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 113 (V113A)
Ref Sequence ENSEMBL: ENSMUSP00000149686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050433] [ENSMUST00000214596] [ENSMUST00000217462]
Predicted Effect probably damaging
Transcript: ENSMUST00000050433
AA Change: V113A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057965
Gene: ENSMUSG00000031997
AA Change: V113A

DomainStartEndE-ValueType
low complexity region 37 54 N/A INTRINSIC
ANK 96 125 4.73e2 SMART
ANK 131 159 3.49e0 SMART
ANK 217 246 6.61e-1 SMART
Pfam:TRP_2 252 314 4e-29 PFAM
transmembrane domain 406 427 N/A INTRINSIC
Pfam:Ion_trans 442 738 4.2e-38 PFAM
Pfam:PKD_channel 477 733 3.1e-16 PFAM
low complexity region 770 781 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214596
AA Change: V113A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217462
AA Change: V113A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one null targeted mutation are viable and fertile and exhibit no overt abnormal phenotype. Another knockout results in an increase in thermal nociceptive response latency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,485 I1145T probably damaging Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abhd16a A T 17: 35,101,883 T436S probably benign Het
Acbd5 G T 2: 23,099,584 L406F probably damaging Het
Agrn G A 4: 156,172,401 T1142M probably benign Het
Aig1 C A 10: 13,801,930 W106L probably damaging Het
Akr1d1 T C 6: 37,557,600 probably null Het
Ap1g1 G A 8: 109,855,082 D658N possibly damaging Het
Arhgap45 A G 10: 80,026,172 Y520C probably damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Asic5 C T 3: 81,999,809 T47I possibly damaging Het
BC052040 A G 2: 115,581,888 I2V probably benign Het
Cabp5 A G 7: 13,400,739 probably null Het
Ccr6 A T 17: 8,256,064 R34* probably null Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Cmtr1 A G 17: 29,700,242 E704G possibly damaging Het
Cyth3 G A 5: 143,684,479 probably null Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dennd6b T C 15: 89,185,592 H468R probably benign Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Dpp6 A G 5: 27,712,659 Y616C probably damaging Het
Dync2h1 A T 9: 7,006,862 S3710T probably benign Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Emc3 G A 6: 113,531,349 T45I possibly damaging Het
Esf1 T A 2: 140,124,971 D685V probably damaging Het
Ezr A G 17: 6,741,576 S366P probably benign Het
Gbe1 C T 16: 70,495,253 A491V probably damaging Het
Haus6 A G 4: 86,600,749 probably null Het
Heca G A 10: 17,915,187 Q12* probably null Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A T 8: 110,523,208 Q2261L probably benign Het
Itgae G T 11: 73,114,880 R290L possibly damaging Het
Kcna10 C A 3: 107,195,492 L480I probably benign Het
Kif27 T C 13: 58,328,971 T622A probably benign Het
Lama2 T C 10: 27,204,929 N966S probably damaging Het
Mdfic A G 6: 15,741,020 K38E possibly damaging Het
Med25 G A 7: 44,892,288 A26V probably damaging Het
Mrpl19 A T 6: 81,964,348 S77R probably damaging Het
Mybpc2 T C 7: 44,512,547 D493G probably damaging Het
Myh4 A G 11: 67,240,920 T69A probably benign Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo9b T C 8: 71,356,592 L1815P probably damaging Het
Myom2 T A 8: 15,081,271 L323Q probably damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nktr T A 9: 121,749,739 probably benign Het
Nol10 A G 12: 17,355,287 K88E probably damaging Het
Nol4 T C 18: 22,718,993 D505G probably damaging Het
Nynrin T A 14: 55,863,997 N374K probably damaging Het
Obscn A T 11: 59,063,536 L3740Q probably damaging Het
Olfr1000 T C 2: 85,607,983 H309R probably benign Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pgm5 G A 19: 24,834,805 A121V probably damaging Het
Pi4ka A T 16: 17,377,175 Y120N probably benign Het
Rpl36al G A 12: 69,182,958 A60V possibly damaging Het
Rspo4 T C 2: 151,843,134 Y21H probably benign Het
Scube2 A G 7: 109,831,205 V455A probably benign Het
Serpina1f T C 12: 103,693,546 D159G probably damaging Het
Sf1 A G 19: 6,365,664 D11G probably damaging Het
Siglecg T C 7: 43,417,908 F633S probably benign Het
Skiv2l A G 17: 34,848,197 S89P possibly damaging Het
Slc22a13 T C 9: 119,193,632 E501G probably damaging Het
Slc44a3 A G 3: 121,510,206 S294P probably damaging Het
Smad3 T G 9: 63,757,560 K40Q probably damaging Het
Soga1 T A 2: 157,020,554 D1485V probably damaging Het
Stt3a T A 9: 36,749,712 M268L probably benign Het
Taf4 A T 2: 179,924,494 V817E probably damaging Het
Tgfbr1 A G 4: 47,383,835 T58A probably benign Het
Ttll13 T A 7: 80,248,276 probably null Het
Uba7 T C 9: 107,980,165 L742P probably benign Het
Ulk2 A G 11: 61,833,435 L174P probably damaging Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Unc80 A T 1: 66,649,672 probably null Het
Usp34 T A 11: 23,393,749 probably null Het
Vmn1r71 A T 7: 10,747,864 V233D possibly damaging Het
Xpo6 T C 7: 126,140,583 K439R probably benign Het
Xrn1 G T 9: 96,033,636 G1271C probably damaging Het
Yes1 A T 5: 32,660,777 E386V probably damaging Het
Zfp759 C A 13: 67,139,344 H320N probably damaging Het
Zfp990 A T 4: 145,536,942 H170L possibly damaging Het
Other mutations in Trpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Trpc6 APN 9 8680438 missense probably damaging 1.00
IGL00469:Trpc6 APN 9 8626701 missense probably benign
IGL00970:Trpc6 APN 9 8653151 missense probably damaging 1.00
IGL01299:Trpc6 APN 9 8653061 missense probably damaging 1.00
IGL01563:Trpc6 APN 9 8656603 missense probably damaging 1.00
IGL01578:Trpc6 APN 9 8634057 missense probably damaging 1.00
IGL02657:Trpc6 APN 9 8643601 missense possibly damaging 0.94
IGL02735:Trpc6 APN 9 8655338 missense probably damaging 1.00
IGL03102:Trpc6 APN 9 8649301 missense probably benign 0.07
P0038:Trpc6 UTSW 9 8649511 missense possibly damaging 0.52
PIT4531001:Trpc6 UTSW 9 8610148 missense probably benign 0.14
R0100:Trpc6 UTSW 9 8653034 missense probably damaging 1.00
R0100:Trpc6 UTSW 9 8653034 missense probably damaging 1.00
R0323:Trpc6 UTSW 9 8610275 missense probably damaging 1.00
R0323:Trpc6 UTSW 9 8643536 missense probably damaging 1.00
R0334:Trpc6 UTSW 9 8610343 missense probably damaging 1.00
R0665:Trpc6 UTSW 9 8634122 missense probably benign 0.11
R0948:Trpc6 UTSW 9 8610415 missense possibly damaging 0.60
R1177:Trpc6 UTSW 9 8658304 missense probably benign 0.04
R1217:Trpc6 UTSW 9 8658286 intron probably null
R1445:Trpc6 UTSW 9 8680537 missense probably benign 0.00
R1452:Trpc6 UTSW 9 8653147 missense probably damaging 0.99
R1494:Trpc6 UTSW 9 8658304 missense probably benign 0.04
R1501:Trpc6 UTSW 9 8610169 missense probably damaging 0.99
R1933:Trpc6 UTSW 9 8656545 missense probably damaging 1.00
R2112:Trpc6 UTSW 9 8656612 missense probably damaging 1.00
R2164:Trpc6 UTSW 9 8610465 nonsense probably null
R2921:Trpc6 UTSW 9 8653033 missense possibly damaging 0.94
R2995:Trpc6 UTSW 9 8544466 missense probably benign 0.30
R3821:Trpc6 UTSW 9 8610278 missense probably damaging 1.00
R3965:Trpc6 UTSW 9 8626621 missense probably damaging 1.00
R4360:Trpc6 UTSW 9 8610266 missense probably benign 0.10
R4625:Trpc6 UTSW 9 8677962 missense probably benign 0.40
R4691:Trpc6 UTSW 9 8652978 missense probably damaging 1.00
R4767:Trpc6 UTSW 9 8643686 missense probably damaging 1.00
R4773:Trpc6 UTSW 9 8609851 missense possibly damaging 0.78
R4792:Trpc6 UTSW 9 8626614 missense probably benign 0.00
R5105:Trpc6 UTSW 9 8649470 missense probably benign
R5319:Trpc6 UTSW 9 8609921 missense probably damaging 1.00
R5429:Trpc6 UTSW 9 8634074 nonsense probably null
R5505:Trpc6 UTSW 9 8626735 missense probably damaging 1.00
R5657:Trpc6 UTSW 9 8609807 missense probably benign 0.11
R5684:Trpc6 UTSW 9 8653128 missense probably damaging 1.00
R5722:Trpc6 UTSW 9 8680549 missense possibly damaging 0.88
R6210:Trpc6 UTSW 9 8656730 missense probably benign 0.42
R6284:Trpc6 UTSW 9 8643600 missense possibly damaging 0.93
R6773:Trpc6 UTSW 9 8634057 missense probably damaging 1.00
R6874:Trpc6 UTSW 9 8680438 missense probably damaging 1.00
R7032:Trpc6 UTSW 9 8609950 missense probably damaging 1.00
R7142:Trpc6 UTSW 9 8653016 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTATTGCAGCCGGGGTAATG -3'
(R):5'- CAGCAAAAGCTGGATGGTTG -3'

Sequencing Primer
(F):5'- TTATTGCAGCCGGGGTAATGAAAAC -3'
(R):5'- CCGTACATAACCTTTACTAATGGC -3'
Posted On2015-11-11