Incidental Mutation 'R4736:Slc22a13'
ID359265
Institutional Source Beutler Lab
Gene Symbol Slc22a13
Ensembl Gene ENSMUSG00000074028
Gene Namesolute carrier family 22 (organic cation transporter), member 13
SynonymsOCTL1, ORCTL3, OCTL3
MMRRC Submission 041963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R4736 (G1)
Quality Score173
Status Not validated
Chromosome9
Chromosomal Location119192974-119209098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119193632 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 501 (E501G)
Ref Sequence ENSEMBL: ENSMUSP00000081855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084797] [ENSMUST00000093775] [ENSMUST00000127794] [ENSMUST00000170400]
Predicted Effect probably damaging
Transcript: ENSMUST00000084797
AA Change: E501G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081855
Gene: ENSMUSG00000074028
AA Change: E501G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 104 514 2.2e-41 PFAM
Pfam:MFS_1 133 468 2.6e-26 PFAM
Pfam:MFS_1 355 537 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093775
SMART Domains Protein: ENSMUSP00000091289
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 156 556 1.3e-28 PFAM
Pfam:MFS_1 178 514 7.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127794
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 4. The encoded protein is a transmembrane protein involved in the transport of small molecules. This protein can function to mediate urate uptake and is a high affinity nicotinate exchanger in the kidneys and the intestine. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,485 I1145T probably damaging Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abhd16a A T 17: 35,101,883 T436S probably benign Het
Acbd5 G T 2: 23,099,584 L406F probably damaging Het
Agrn G A 4: 156,172,401 T1142M probably benign Het
Aig1 C A 10: 13,801,930 W106L probably damaging Het
Akr1d1 T C 6: 37,557,600 probably null Het
Ap1g1 G A 8: 109,855,082 D658N possibly damaging Het
Arhgap45 A G 10: 80,026,172 Y520C probably damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Asic5 C T 3: 81,999,809 T47I possibly damaging Het
BC052040 A G 2: 115,581,888 I2V probably benign Het
Cabp5 A G 7: 13,400,739 probably null Het
Ccr6 A T 17: 8,256,064 R34* probably null Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Cmtr1 A G 17: 29,700,242 E704G possibly damaging Het
Cyth3 G A 5: 143,684,479 probably null Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dennd6b T C 15: 89,185,592 H468R probably benign Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Dpp6 A G 5: 27,712,659 Y616C probably damaging Het
Dync2h1 A T 9: 7,006,862 S3710T probably benign Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Emc3 G A 6: 113,531,349 T45I possibly damaging Het
Esf1 T A 2: 140,124,971 D685V probably damaging Het
Ezr A G 17: 6,741,576 S366P probably benign Het
Gbe1 C T 16: 70,495,253 A491V probably damaging Het
Haus6 A G 4: 86,600,749 probably null Het
Heca G A 10: 17,915,187 Q12* probably null Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A T 8: 110,523,208 Q2261L probably benign Het
Itgae G T 11: 73,114,880 R290L possibly damaging Het
Kcna10 C A 3: 107,195,492 L480I probably benign Het
Kif27 T C 13: 58,328,971 T622A probably benign Het
Lama2 T C 10: 27,204,929 N966S probably damaging Het
Mdfic A G 6: 15,741,020 K38E possibly damaging Het
Med25 G A 7: 44,892,288 A26V probably damaging Het
Mrpl19 A T 6: 81,964,348 S77R probably damaging Het
Mybpc2 T C 7: 44,512,547 D493G probably damaging Het
Myh4 A G 11: 67,240,920 T69A probably benign Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo9b T C 8: 71,356,592 L1815P probably damaging Het
Myom2 T A 8: 15,081,271 L323Q probably damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nktr T A 9: 121,749,739 probably benign Het
Nol10 A G 12: 17,355,287 K88E probably damaging Het
Nol4 T C 18: 22,718,993 D505G probably damaging Het
Nynrin T A 14: 55,863,997 N374K probably damaging Het
Obscn A T 11: 59,063,536 L3740Q probably damaging Het
Olfr1000 T C 2: 85,607,983 H309R probably benign Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pgm5 G A 19: 24,834,805 A121V probably damaging Het
Pi4ka A T 16: 17,377,175 Y120N probably benign Het
Rpl36al G A 12: 69,182,958 A60V possibly damaging Het
Rspo4 T C 2: 151,843,134 Y21H probably benign Het
Scube2 A G 7: 109,831,205 V455A probably benign Het
Serpina1f T C 12: 103,693,546 D159G probably damaging Het
Sf1 A G 19: 6,365,664 D11G probably damaging Het
Siglecg T C 7: 43,417,908 F633S probably benign Het
Skiv2l A G 17: 34,848,197 S89P possibly damaging Het
Slc44a3 A G 3: 121,510,206 S294P probably damaging Het
Smad3 T G 9: 63,757,560 K40Q probably damaging Het
Soga1 T A 2: 157,020,554 D1485V probably damaging Het
Stt3a T A 9: 36,749,712 M268L probably benign Het
Taf4 A T 2: 179,924,494 V817E probably damaging Het
Tgfbr1 A G 4: 47,383,835 T58A probably benign Het
Trpc6 T C 9: 8,609,870 V113A probably damaging Het
Ttll13 T A 7: 80,248,276 probably null Het
Uba7 T C 9: 107,980,165 L742P probably benign Het
Ulk2 A G 11: 61,833,435 L174P probably damaging Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Unc80 A T 1: 66,649,672 probably null Het
Usp34 T A 11: 23,393,749 probably null Het
Vmn1r71 A T 7: 10,747,864 V233D possibly damaging Het
Xpo6 T C 7: 126,140,583 K439R probably benign Het
Xrn1 G T 9: 96,033,636 G1271C probably damaging Het
Yes1 A T 5: 32,660,777 E386V probably damaging Het
Zfp759 C A 13: 67,139,344 H320N probably damaging Het
Zfp990 A T 4: 145,536,942 H170L possibly damaging Het
Other mutations in Slc22a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02828:Slc22a13 APN 9 119195707 missense probably benign 0.25
IGL02871:Slc22a13 APN 9 119196011 missense probably benign 0.01
R0764:Slc22a13 UTSW 9 119208680 splice site probably null
R1469:Slc22a13 UTSW 9 119193295 missense possibly damaging 0.67
R1469:Slc22a13 UTSW 9 119193295 missense possibly damaging 0.67
R1545:Slc22a13 UTSW 9 119209047 missense probably benign 0.00
R2154:Slc22a13 UTSW 9 119208687 missense probably benign 0.00
R2321:Slc22a13 UTSW 9 119195628 missense possibly damaging 0.61
R3808:Slc22a13 UTSW 9 119196077 missense probably benign
R3840:Slc22a13 UTSW 9 119208789 missense probably benign 0.18
R6286:Slc22a13 UTSW 9 119208712 nonsense probably null
R6899:Slc22a13 UTSW 9 119196407 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACCCAACACATTGTGC -3'
(R):5'- TGCTCTTTCCCCAGGCAAAC -3'

Sequencing Primer
(F):5'- CCAACACATTGTGCGAGATGGTTC -3'
(R):5'- CAAACAGGCATGGGGTTGGTG -3'
Posted On2015-11-11